Synthetic Gene DataBase
 

Synthetic Gene 242


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID217242
GenBank AccessionU59102
GenBank GI4204916
Gene NamenBlo t 5 (native)cBlo t 5 (recombinant)
Gene Length (bp)5371
SpeciesBlomina tropicalisChinese Hamster
StrainsCHO-K1
CDSaaaacactcacaatccacaaactcaaacaacaatgaagttcgccatcgttcttattgcct
gctttgccgcttcggttttggctcaagagcacaagccaaagaaggatgatttccgaaacg
aattcgatcacttgttgatcgaacaggcaaaccatgctatcgaaaagggagaacatcaat
tgctttacttgcaacaccaactcgacgaattgaatgaaaacaagagcaaggaattgcaag
agaaaatcattcgagaacttgatgttgtttgcgccatgatcgaaggagcccaaggagctt
tggaacgtgaattgaagcgaactgatcttaacattttggaacgattcaactacgaagagg
ctcaaactctcagcaagatcttgcttaaggatttgaaggaaaccgaacaaaaagtgaagg
atattcaaacccaataaaaatttagaattgtacaattttacatttttgatatgattaaat
gtcaataaatgttcaataaataaattcaatttttaactataaaaaaaaaaaaaaaaa
5' End
3' End
NotesB1 5'-CCCCCCGGATCCACCATGGAGCAGGAGCACAAGCCC-3' B2 5'-CAGGAGCACAAGCCCAAGAAGGACGACTTCAGGAACGAGTTCGACCACTTGCTGATCGAG-3' B3 5'-GACCACTTGCTGATCGAGCAGGCtAACCACGCGATCGAAAAGGGGGAGCATCAACTGCTC-3' B4 5'-GGGGAGCATCAACTGCTCTACCTGCAGCACCAGCTCGACGAGCTGAATGAGAACAAGAGC-3' B5 5'-CTGAATGAGAACAAGAGCAAGGAACTGCAGGAGAAAATCATCCGCGAGCTTGATGTGGTC-3' B6 5'-CGCGAGCTTGATGTGGTCTGCGCCATGATCGAAGGCGCCCAGGGCGCCCTGGAGCGCGAG-3' B7 5'-GGCGCCCTGGAGCGCGAGCTGAAGCGGACGGACCTCAACATCCTGGAGCGCTTTAACTAC-3' B8 5'-CTGGAGCGCTTTAACTACGAAGAGGCCCAGACTCTCTCCAAGATCCTGCTCAAGGACCTG-3' B9 5'-ATCCTGCTCAAGGACCTGAAGGAGACCGAGCAGAAAGTGAAGGACATTCAGACCCAGTGATCTAGACCCCCC-3' V1 5'-CCCCCCGGATCCCGGGCGAACTGCGTGGTTTTAAGTGACTATATCCCCAGGGTCGCC-3' V2 5'-GCCCACCACAGGCTTATTCACTGTGCCCATGGTGGCGTTACAGGCGACCCTGGGGATATAG-3' V3 5'-AATAAGCCTGTGGTGGGCGTACTGATGGGGTTCGGAATCATCACGGGTACCTTGCGTATA-3' V4 5'-CCTTCTTGGGCTTGTGCTCCTGTCTTGCTCTGACCGGGTTGGTTATACGCAAGGTACCCGTG-3' V5 5'-CCAACCCGGTCAGAGCAAGACAGGAGCACAAGCCCAAGAAGG-3'
Expression VectorpGEMTpGEMT-cBlo t 5
Assay MethodsSDS-PAGE, Western Blot, Sandwich ELISA, Human IgE ELISAWestern Blot, Sandwich ELISA, Human IgE ELISA
ResultsModerate levels of protein were expressed in CHO-K1 cells.Up to 13 mg/L suspension culture. IgE reactivity was strongly correlated to that of nBlo t 5, indicating correct protein activity.
Protein Functionmajor IgE-binding protein
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodAuthors wished to achieve a closer percentage frequency for individual codons to that of highly
expressed human genes.
Publication Author(s)Lim, L. H.; Li, H. Y.; Cheong, N.; Lee, B. W.; Chua, K. Y.
Corresponding AuthorK. Y. Chua
Corresponding AddressDepartment of Paediatrics, National University of Singapore, Singapore.
Publication Year2004
Publication TitleHigh-level expression of a codon optimized recombinant dust mite allergen, Blo t 5, in Chinese hamster ovary cells
AbstractBlo t 5 is a major allergen from house dust mite Blomia tropicalis. Purification of native Blo t 5 (nBlo t 5) from whole dust mite extract is tedious and gave low yield. In this study, we demonstrated that codon optimization facilitated high-level expression of Blo t 5 in Chinese hamster ovary (CHO)-K1 cells and thus allows production of sufficient recombinant cBlo t 5 for specific immunotherapy. A codon optimized Blo t 5 gene was synthesized by PCR and the codon optimized or wild-type Blo t 5 gene in pcDNA3.0 was transfected into CHO-K1 cells and stably selected with Geneticin (G418). Western-immunoblot analysis of spent culture media detected a positive band at 14kDa for the codon optimized but not wild-type gene transfectants. In addition, a stable CHO-K1 clone produced up to 13 mg/L of the cBlo t 5 protein having a high correlation of human IgE reactivities and allergenicity to the native Blo t 5, thus indicating proper conformation of this recombinant form.
JournalBiochem Biophys Res Commun. 316(4): 991-6.
SummaryBlo t 5 is a house dust mite allergen. The authors found it difficult to extract high purity allergen from whole dust mite extract and instead devised a way to synthesize Blo t 5 for immunotherapy. The authors used CHO-K1 cells to grow up both wild-type nBlo t 5 and recombinant cBlo t 5. The cBlo t 5 was synthesized by PCR partially priming overlapping oligonucleotides. The gene was also recoded to make individual codon usage similar to highly expressed human genes. Protein expression of cBlo t 5 was evidently improved over that of nBlo t 5 from SDS-PAGE results. One CHO-K1 cell line expressing cBlo t 5 produced as much as 13 mg protein per liter suspended culture. The recombinant gene was shown to have similar IgE reactivity to the wild-type nBlo t 5.
Comments
Discussion
PubMed ID15044082
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site