Synthetic Gene DataBase
 

Synthetic Gene 25


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID1825
GenBank AccessionAF123609
GenBank GI10442762
Gene NameCYP85A5CYP85A5 R1
Gene Length (bp)16261626
SpeciesTriticum aestivumSaccharomyces cerevisiae
StrainsClone CYP85-TAWAT11
CDSatggaggtggggacgtgggcggtggtggtgtcggcggtggccgcgtacatggcgtggttc
tggcggatgtcccgcgggctgcgcgggccgcgggtttggcccgtgctcggcagcctgccg
ggcctggtgcagcacgccgaggacatgcacgagtggatcgccggcaacctgcgccgcgcg
ggcggcacgtaccagacctgcatcttcgccgtgcccggggtggcgcgccgcggcggcctg
gtcaccgtcacctgcgacccgcgcaacctggagcacgtcctgaaggcgcgcttcgacaac
taccccaagggccccttctggcacggcgtcttccgggacctgctcggcgacggcatcttc
aattccgacggcgacacctggctcgcgcagcgcaagacggccgcgctcgagttcaccacc
cgcacgctccggacggccatgtcccgctgggtctcgcgctccatccacggccgcctcctg
cccatcctggccgacgcggccaagggcaaggcgcaggtggatctccaggacctcctcctc
cgcctcaccttcgacaacatctgcggcctggccttcggcaaggacccggagacgctcgcc
cagggcctgccggagaacgagttcgcctccgcgttcgaccgcgccaccgaggccacgctc
aaccgcttcatcttcccggagttcctgtggcgctgcaaaaagtggctgggcctcggcatg
gagaccacgctgaccagcagcatggcccacgtcgaccagtacctcgccgccgtcatcaag
aagcgcaagctcgagctcgccgccggcaacggcaaatgcgacacggcggcgacgcacgac
gacctgctctcccggttcatgcggaagggttcctactcggacgagtcgctccagcacgtg
gcgctcaacttcatcctcgccggccgcgacacctcctccgtggcgctctcctggttcttc
tggctcgtgtccacccaccctgcggtggagcgcaagatcgtgcgcgagctctgctccgtt
ctcgccgcgtcacggggcgcccatgacccggcattgtggctggcggagcccttcaccttc
gaggagctcgaccgcctggtctacctcaaggcggcgctgtcggagaccctccgcctctac
ccctccgtccccgaggactccaagcacgtcgtcgcggacgactacctccccgacggcacc
ttcgtgccggccgggtcgtcggtcacctactccatatactcggcggggcgcatgaagggg
gtgtggggggaggactgcctcgagttccggccggagcgatggctgtcggccgacggcacc
aagttcgagcagcacgactcgtacaagttcgtggcgttcaacgccgggccgagggtgtgc
ctgggcaaggacctagcctacctgcagatgaagaacatcgccgggagcgtgctgctccgg
caccgcctgaccgtggcgccgggccaccgcgtggagcagaagatgtcgctcacgctcttc
atgaagggcgggctacggatggaggtacgtccgcgcgacctcgcccccgtcctcgacgag
ccctgcggcctggacgccggcgccgccaccgccgccgcagcaagtgccacagcgccgtgc
gcgtag
atggaagttggtacttgggctgttgttgtttctgctgttgctgcttatatggcttggttt
tggagaatgtctagaggtttgagaggtccaagagtttggccagttttgggttctttgcca
ggcctggtgcagcacgccgaggacatgcacgagtggatcgccggcaacctgcgccgcgcg
ggcggcacgtaccagacctgcatcttcgccgtgcccggggtggcgcgccgcggcggcctg
gtcaccgtcacctgcgacccgcgcaacctggagcacgtcctgaaggcgcgcttcgacaac
taccccaagggccccttctggcacggcgtcttccgggacctgctcggcgacggcatcttc
aattccgacggcgacacctggctcgcgcagcgcaagacggccgcgctcgagttcaccacc
cgcacgctccggacggccatgtcccgctgggtctcgcgctccatccacggccgcctcctg
cccatcctggccgacgcggccaagggcaaggcgcaggtggatctccaggacctcctcctc
cgcctcaccttcgacaacatctgcggcctggccttcggcaaggacccggagacgctcgcc
cagggcctgccggagaacgagttcgcctccgcgttcgaccgcgccaccgaggccacgctc
aaccgcttcatcttcccggagttcctgtggcgctgcaaaaagtggctgggcctcggcatg
gagaccacgctgaccagcagcatggcccacgtcgaccagtacctcgccgccgtcatcaag
aagcgcaagctcgagctcgccgccggcaacggcaaatgcgacacggcggcgacgcacgac
gacctgctctcccggttcatgcggaagggttcctactcggacgagtcgctccagcacgtg
gcgctcaacttcatcctcgccggccgcgacacctcctccgtggcgctctcctggttcttc
tggctcgtgtccacccaccctgcggtggagcgcaagatcgtgcgcgagctctgctccgtt
ctcgccgcgtcacggggcgcccatgacccggcattgtggctggcggagcccttcaccttc
gaggagctcgaccgcctggtctacctcaaggcggcgctgtcggagaccctccgcctctac
ccctccgtccccgaggactccaagcacgtcgtcgcggacgactacctccccgacggcacc
ttcgtgccggccgggtcgtcggtcacctactccatatactcggcggggcgcatgaagggg
gtgtggggggaggactgcctcgagttccggccggagcgatggctgtcggccgacggcacc
aagttcgagcagcacgactcgtacaagttcgtggcgttcaacgccgggccgagggtgtgc
ctgggcaaggacctagcctacctgcagatgaagaacatcgccgggagcgtgctgctccgg
caccgcctgaccgtggcgccgggccaccgcgtggagcagaagatgtcgctcacgctcttc
atgaagggcgggctacggatggaggtacgtccgcgcgacctcgcccccgtcctcgacgag
ccctgcggcctggacgccggcgccgccaccgccgccgcagcaagtgccacagcgccgtgc
gcgtag
5' Endatatatggatccatatatggatcc
3' Endaaggaattctatataaaggaattctatata
Notes
Expression Vector
Assay MethodsP450 CO-binding spectraP450 CO-binding spectra
ResultsUndetectableDetectable increase
Protein FunctionCytochrome P450
Recoding PurposeTo improve expression
Synthesized ByAuthor
Recoding MethodFirst 40 codons were optimized with reference to yeast highly expressed genes (Sharp and Cowe,
1991).
Publication Author(s)Batard, Y.; Hehn, A.; Nedelkina, S.; Schalk, M.; Pallett, K.; Schaller, H.; Werck-Reichhart, D.
Corresponding AuthorDaniele Werck-Reichhart
Corresponding AddressDepartement d'Enzymologie Cellulaire et Moleculaire, Institut de Biologie Moleculaire des Plantes, Centre National de la Recherche Scientifique FRE 2161, 28 rue Goethe, Strasbourg Cedex, 67083, France.
Publication Year2000
Publication TitleIncreasing expression of P450 and P450-reductase proteins from monocots in heterologous systems
AbstractMonocotyledonous crop plants are usually more resistant to herbicides than grass weeds and most dicots. Their resistance to herbicides is mediated in many cases by P450 oxygenases. Monocots thus constitute an appealing source of P450 enzymes for manipulating herbicide resistance and recombinant forms of the major xenobiotic metabolizing mooxygenases are potential tools for the optimization of new active molecules. We report here the isolation and functional characterization of the first P450 and P450 reductase coding sequences from wheat. The first attempts at expressing these cDNAs in yeast and tobacco led to levels of protein, which were extremely low, often not even detectable. The wheat P450 cDNAs were efficiently transcribed, but no protein or activity was found. Wheat coding sequences, like those of other monocots, are characterized by a high GC content and by a related strong bias of codon usage, different from that observed in yeast or dicots. Complete recoding of genes being costly, the reengineering their 5'-end using a single PCR megaprimer designed to comply with codon usage of the host was attempted. It was sufficient to relieve translation inhibition and to obtain good levels of protein expression. The same strategy also resulted in a dramatic increase in protein expression in tobacco. A basis for the success of such a partial recoding strategy, much easier and cheaper than complete recoding of the cDNA, is proposed.
JournalArch Biochem Biophys. 379(1): 161-9.
SummaryThe N-terminal part of three wheat genes were optimized with reference to the the codon usage in highly expressed genes. As measured by the P450 CO-binding essay, the codon optimization increased the protein expression. However, the expression seems to be only slightly improved when looking at the western blot results.
CommentsThe first 17 codons of TAR1 gene in the paper were not showed in GenBank but have been manually added
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=518
PubMed ID10864454
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site