Synthetic Gene DataBase
 

Synthetic Gene 250


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID220250
GenBank Accession
GenBank GI
Gene NamecGATA-1synthetic cGATA-1
Gene Length (bp)915915
SpeciesGallus gallusEscherichia coli
Strains
CDSatggagttcgtggcgctgggggggcccgatgcgggctcccccactccgttccctgatgaa
gccggagccttcctggggctgggggggggcgagaggacggaggcgggggggctgctggcc
tcctaccccccctcaggccgcgtgtccctggtgccgtgggcagacacgggtactttgggg
accccccagtgggtgccgcccgccacccaaatggagcccccccactacctggagctgctg
caacccccccggggcagccccccccatccctcctccgggcccctactgccactcagcagc
gggcccccaccctgcgaggcccgtgagtgcgtcaactgcggagcgacggcaacgccgctg
tggcgccgggacggcaccgggcattacctgtgcaacgcctgcgggctctaccaccgcctc
aacggccagaaccgcccgctcatccgccccaaaaagcgcctgctggtgagtaagcgcgca
ggcacagtgtgcagcaactgccagacatccaccaccactctgtggcgtcgcagccccatg
ggggaccccgtctgcaacgcctgcggcctctactacaaactgcaccaagtgaaccgcccc
ctcacgatgcgcaaagacggaatccaaacccgaaaccgcaaagtttcctccaagggtaaa
aagcggcgccccccgggggggggaaacccctccgccaccgcgggagggggcgctcctatg
gggggagggggggacccctctatgccccccccgccgccccccccggcccccgccccccct
caaagcgacgctctgtacgctctgggccccgtggtcctttcgggccattttctgcccttt
ggaaactccggagggttttttggggggggggcggggggttacacggcccccccggggctg
agcccgcagatttga
atggagttcgtggcgctgggggggcccgatgcgggctcccccactccgttccctgatgaa
gccggagccttcctggggctgggggggggcgagaggacggaggcgggggggctgctggcc
tcctaccccccctcaggccgcgtgtccctggtgccgtgggcagacacgggtactttgggg
accccccagtgggtgccgcccgccacccaaatggagcccccccactacctggagctgctg
caacccccccggggcagccccccccatccctcctccgggcccctactgccactcagcagc
gggcccccaccctgcgaggcccgtgagtgcgtcaactgcggagcgacggcaacgccgctg
tggcgccgggacggcaccgggcattacctgtgcaacgcctgcgggctctaccaccgcctc
aacggccagaaccgcccgctcatccgccccaaaaagcgcctgctggtgagtaagcgcgca
ggcacagtgtgcagcaactgccagacatccaccaccactctgtggcgtcgcagccccatg
ggggaccccgtctgcaacgcctgcggcctctactacaaactgcaccaagtgaaccgcccc
ctcacgatgcgcaaagacggaatccaaacccgaaaccgcaaagtttcctccaagggtaaa
aagcggcgcccgccgggtggtggtaatccgtctgcaactgctggtggcggcgctcctatg
ggtggtgggggtgacccgtctatgccgccgccaccgccaccgccggcaccagccccgcct
caaagcgacgctctgtacgctctgggcccggtggtcctttcgggccattttctgccgttt
ggtaactccggtggcttttttggcggtggtgcgggcggttacacggccccgccggggctg
agcccgcagatttga
5' End
3' End
Notes
Expression Vector
Assay Methods
Results
Protein Function
Recoding PurposeTo improve expression
Synthesized By
Recoding Method
Publication Author(s)Pikaart, M. J.; Felsenfeld, G.
Corresponding Author
Corresponding AddressLaboratory of Molecular Biology, National Institute of Diabetes and Digestion and Kidney Disease, National Institutes of Health, Bethesda, Maryland 20892-0540, USA.
Publication Year1996
Publication TitleExpression and codon usage optimization of the erythroid-specific transcription factor cGATA-1 in baculoviral and bacterial systems
AbstractBiochemical characterization of cGATA-1, a key transcription factor in the regulation of globin expression in chickens, has been precluded by the unavailability of appreciable amounts of the pure protein. Purification directly from embryonic red blood cells has been limited by the difficulty in obtaining large quantities of the starting material, and previous attempts at bacterial expression have consistently yielded truncated product. To solve these problems, we have taken two approaches to the expression of cGATA-1. First, we were able to produce efficient expression from baculovirus-infected insect cells. Second, by altering the codon usage in cDNA encoding the protein's carboxy-terminal region, we obtained good expression of full-length protein in Escherichia coli. These preparations should prove useful in biochemical and structural studies of the factor. Additionally, we describe a primer extension/PCR-based method which can be used to synthesize extended regions of DNA sequence for gene construction.
JournalProtein Expr Purif. 8(4): 469-75.
Summary
Comments
Discussion
PubMed ID8954895
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site