Synthetic Gene DataBase
 

Synthetic Gene 251


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID221251
GenBank AccessionU25648AY327442
GenBank GI125657033087200
Gene NameLK-w (lumbrokinase)LK-m
Gene Length (bp)849849
SpeciesLumbricus rubellusShannon goats
Strains
CDSatgttacttctcgctcttgcatcgctcgtagcggtgggctttgcccaaccaccaatctgg
taccccggtggtcaatgcggtctcagccagtactcagatgctggtgacatggaacttcct
cccggaacaaaaattgtcggaggaattgaagctagaccatacgagttcccgtggcaggtg
tccgtccgaaggaagtcttccgattcccatttctgcggaggtagcatcatcaacgatcgt
tgggttgtctgcgctgctcactgcatgcagggagaggcccccgctctggtttcattggtc
gtgggtgagcacgacaggagtgcagcgagtgcagtacgtcagactcatgacgttgatagc
atcttcgttcacgaggactacaacacaaataccctagagaacgacgtttctgtcatcaag
acatctgttgccatcactttcgacatcaacgttggtccaatctgtgccccagatccagct
caacagtacgtctaccgtaagagccagtgctccggatggggaactatcaattcaggtgga
atctgctgtcccaacattctgcgatacgtgacgctgaatgtcacaaccaaccaattctgc
gaagatgtatacccactaaattcaatcttcgacgatatgatttgcgcgtcggacaacact
gggggtaacgacagagactcctgccagggtgactccggcggccctctgagcgtcaaggat
ggcagtggaatcttcagcctgattggtattgtgtcttggggaattggttgcgcttctggc
tatccaggagtctactcccgcgtcggattccatactgcatggatcaccgacatcatcacc
aacaactaa
atgttacttctcgctcttgcatcactcgtagcagtgggctttgcccaaccaccaatctgg
taccccggtggtcaatgcggtctcagccagtactcagatgctggtgacatggaacttcct
cccggaacaaaaattgtcggaggaattgaagctagaccatacgagttcccatggcaggtg
tccgtcagaaggaagtcttccgattcccatttctgcggaggtagcatcatcaacgatagg
tgggttgtctgcgctgctcactgcatgcagggagaggcccccgctctggtttcattggtc
gtgggtgagcacgacaggagtgcagctagtgcagtaaggcagactcatgacgttgatagc
atcttcgttcacgaggactacaacacaaataccctagagaacgacgtttctgtcatcaag
acatctgttgccatcactttcgacatcaacgttggtccaatctgtgccccagatccagct
caacagtacgtctacagaaagagccagtgctccggatggggaactatcaattcaggtgga
atctgctgtcccaacattctgagatacgtaactctgaatgtcacaaccaaccaattctgc
gaagatgtatacccactaaattcaatcttcgacgatatgatttgcgcttcagacaacact
gggggtaacgacagagactcctgccagggtgactccggcggccctctgagcgtcaaggat
ggcagtggaatcttcagcctgattggtattgtgtcttggggaattggttgcgcttctggc
tatccaggagtctactccagggtcggattccatactgcatggatcaccgacatcatcacc
aacaactaa
5' Endtgcggccgcatgttacttctcgctcttgcatcacttgcggccgcatgttacttctcgctcttgcatcact
3' Endatcaccgacatcatcaccaacaactaaggatccgatcaccgacatcatcaccaacaactaaggatccg
NotesTCG18TCA <- The number indicates the number of the aa, NOT the bp.
Expression VectorpIbCP-LKw-LKwpIbCP-LKm-LKm
Assay MethodsmFAPA (modified fibrin agarose plate assay), SDS-PAGEmFAPA (modified fibrin agarose plate assay), SDS-PAGE
ResultsmFAPA showed fibrinolytic activity at 225,000+/-13,200 tPA units/L.mFAPA showed fibrinolytic activity at 550,000+/-21,600 tPA units/L.
Protein Functionfibrinolytic enzyme
Recoding PurposeTo improve expression
Synthesized ByBioasia Biotech
Recoding Method13 codons were rare codons were replaced, as these codons showed “CG” motifs. Rare codon tables
from Zhang 1991 and Schmitt-Ney 1991 were referenced for this purpose. (TCG18TCA;GCG11GCA;CCG57CCA;
CGA63AGA;CGT80AGT;GCG109GCT; CGT113AGG;GCT166AGA;CGA188AGA; ACG191ACT;GCG216GCT;TCG217TCA;CGC267AGG)
Publication Author(s)Hu, R.; Zhang, S.; Liang, H.; Li, N.; Tu, C.
Corresponding AuthorRongliang Hu
Corresponding AddressLaboratory of Genetic Engineering, Veterinary Institute, Academy of Military Medical Science, 5333 Xi'an Road, Changchun 130062, People's Republic of China. hurongliang@hotmail.com
Publication Year2004
Publication TitleCodon optimization, expression, and characterization of recombinant lumbrokinase in goat milk
AbstractLumbrokinase is an important fibrinolytic enzyme derived from earthworm. Although its cDNA has been isolated and sequenced, there is still no report on expression of the lumbrokinase due to unknown reasons. To determine the elements affecting the expression of lumbrokinase, two copies of a lumbrokinase cDNA(w) obtained by RT-PCR and a synthesized lumbrokinase cDNA(m) with optimized codons were cloned into a mammary-gland-specific expression vector pIbCP. The pIbCP-LK-LK vector preparations were directly injected in the lactating goat mammary glands. Results showed that both LK-w and LK-m were successfully expressed in goat milk. The fibrinolytic activity of the LK-w in milk was 225,000 +/- 13,200 tPA units/L, while that of the LK-m was 550,000 +/- 21,600 tPA units/L, indicating that the codon optimization plays an important role in improving the lumbrokinase expression. The molecular weight of the recombinant lumbrokinase is 31.8 kDa. The main physiochemical features of the recombinant lumbrokinase, including temperature stability, pH resistance, and sensitivity to pepsin, were also clarified. This is the first report on expression and characterization of a genetically engineered lumbrokinase.
JournalProtein Expr Purif. 37(1): 83-8.
SummaryThe authors report the first study of lumbrokinase, a fibrinolytic enzyme derived from earthworn. Using the cDNA, the wild-type gene was recoded for expression in a mammalian system. The CG motifs present in the wild-type lumbrokinase were removed as they were considered rare codons. The extent of recoding was rather selective, as only a total of 13 codons were replaced. Plasmids containing the wild-type and recoded genes were constructed and introduced into goat mammary glands. Protein product was purified from goat milk. Modified fibrin agarose plate assay gave the relative levels lumbrokinase expressed. Expression of the recoded gene was improved approximately 2 fold.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?p=675#675
PubMed ID15294284
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site