Synthetic Gene DataBase
 

Synthetic Gene 252


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID222252
GenBank AccessionNC_001413
GenBank GI9626219
Gene Namegag/pol wtgag/pol optimized
Gene Length (bp)44274427
SpeciesBovine immunodeficiency virusHomo sapiens
Strains293T
CDSatgaagagaagggagttagaaaagaagcttcgtaaggttagggtgacaccccaacaggat
aaatattatactatagggaatcttcaatgggccattagaatgataaatctaatggggatc
aaatgtgtgtgtgacgaggagtgctcggcagcagaggtagcccttatcataacccaattt
tcagctttagacttagaaaattctcctatcagaggtaaggaggaggtggccataaaaaat
actctgaaggttttctggtccctgctggcggggtacaaaccagagagtacagaaacggcc
ctaggatattgggaggcctttacatatagagaaagggaggccagagctgataaggaaggc
gaaattaagagtatttacccttccctaacacagaacacacagaataagaagcagacatcg
aatcagacaaacactcaatcattaccagctatcactactcaagatggtactcctaggttt
gatcctgacctcatgaagcagcttaagatctggtcagacgccactgaaagaaatggggtt
gaccttcatgcagtgaatatattaggggtcattacagcaaacctagtacaggaagaaatt
aaactcctcttgaatagtacacccaagtggagattagatgtacaacttatagaatcaaaa
gtaagagagaaagaaaatgcccacagaacgtggaaacagcatcatccagaagccccaaaa
acagatgaaatcatcggtaaggggcttagttctgctgaacaagccaccctgatctcagta
gaatgcagagaaactttcagacagtgggtgctgcaggcagctatggaggtggcacaggca
aaacatgctaccccaggtcccatcaacattcatcagggacccaaggagccgtacacagac
tttataaatagattagtggcagcccttgaaggtatggcggctccagaaaccacaaaagaa
tacttactccaacatctatctattgatcatgccaatgaagactgccagtctattctaaga
cctttgggacccaacaccccaatggagaaaaaattagaagcatgtagggtagtgggatct
cagaaatcaaagatgcaatttttggtagcagctatgaaagaaatggggatccaatcacca
attccagcagtcttgcctcacacaccagaagcatatgcctcccaaacctcagggcccgag
gatggtaggagatgttacggatgtgggaagacaggacatttgaagaggaattgtaaacag
caaaaatgctaccattgtggcaaacctggccaccaagcaagaaactgcaggtcaaaaaac
gggaagtgctcctctgccccttatgggcagaggagccaaccacagaacaattttcaccag
agcaacatgagttctgtgaccccatctgcaccccctcttatattagattagacaaacagc
cttttataaaggtgttcatagggggaagatgggtaaaagggttagtagacactggagcag
atgaggtagtgcttaagaacatacattgggataggataaaagggtatccagggacaccaa
ttaaacaaattggggtaaatggagtaaatgtggccaaaaggaagacccacgtagagtgga
gatttaaggataagactgggataattgatgtcttgttctcagatactcctgtaaaccttt
ttgggagatctcttctacgtagcatagtgacttgcttcaccctacttgttcacacagaaa
aaatcgaacccctacccgtcaaggtaaggggaccagggcctaaggtaccccagtggccct
tgacaaaagaaaagtatcaggctcttaaggaaattgtgaaagatcttttagcagaaggaa
aaatttccgaagctgcttgggataacccatataataccccagtttttgttataaagaaaa
agggaacgggaagatggaggatgctaatggattttagggaattaaataagataacagtta
aaggacaagaattctctacaggcttaccttaccctccaggaattaaggaatgtgaacact
taactgcaatagatataaaagatgcctactttactatccctttacatgaggactttagac
cctttacagccttctctgtagtccctgtaaatcgagaaggacctatagagaggttccagt
ggaatgttctaccacaaggatgggtatgtagccctgccatttatcagactaccacccaga
agattatagaaaacattaaaaagagtcacccagatgtcatgttgtatcaatatatggatg
atttgttgattgggtctaatagggatgatcataagcaaatagtgcaggaaatcagggata
agttaggatcatatggtttcaagactccagatgaaaaggtccaggaagagagagtgaaat
ggatcggttttgagctcacacccaagaaatggcgttttcagcccaggcaactaaagataa
aaaacccactcacagtaaatgaattacagcaattagtaggtaattgtgtttgggtacagc
cagaagtaaaaatccctctataccccttaaccgatctactgagggataagaccaatctcc
aagaaaagatacaactaacaccagaagccatcaagtgtgtagaagaattcaatctaaaac
taaaagatccagaatggaaagatagaataagagaaggagcagaattagtcataaaaatac
agatggttcctcggggcatagtatttgatctgttgcaagatggaaatcccatatggggag
gagtaaaaggactaaattatgatcattcaaacaaaataaaaaagatacttagaactatga
atgagctgaacagaacagtggtaattatgacaggaagagaagctagtttcctgcttcctg
ggtcttctgaagattgggaagcggcactccagaaggaagaaagtctaacacaaatattcc
cagtaaagttttataggcactcctgcagatggacctccatatgtgggccagtaagagaaa
atctaaccacctactatactgacggagggaagaaagggaaaacagctgcagcagtatatt
ggtgtgaaggaaggactaagtcaaaggtatttccaggaaccaatcaacaggcggaattga
aggccatatgcatggctctcttggatggaccaccaaaaatgaatatcataacagatagta
gatacgcctatgagggaatgagagaagaaccagaaacgtgggccagggaaggaatctggc
tggagattgccaagatattgccctttaagcagtacgtgggggtcgggtgggtgcctgcac
ataaagggataggaggaaatacagaggcagatgaaggagttaagaaagccttagaacaga
tggccccgtgtagccctcctgaggccattctattaaaaccaggagaaaaacaaaatctgg
agacagggatctacatgcaggggcttagaccacaaagcttcctcccaagagcagacttac
cagtagccatcacaggaaccatggtagattcagagctacagctacagctacttaacatag
gaactgagcatataagaatccaaaaagatgaggtcttcatgacctgtttcctagaaaata
tcccctcagccactgaagatcatgagagatggcatacctcaccagacattttggttaggc
agttccatctccctaagagaatagctaaagagatagtagccagatgccaagaatgtaaaa
ggacaaccactagcccagtcagaggaacaaaccccagaggtcgattcttatggcagatgg
acaatactcactggaataaaacaattatttgggtagcagtagagacaaattcaggattag
tggaagctcaggtgatccctgaagaaacagcactacaagtagctctctgcattttacagc
taatccagagatatacagttcttcacttacatagtgacaacgggccgtgctttactgcac
acaggatagaaaatctatgtaagtatctggggatcacaaaaactacgggaataccctaca
acccacaatcccagggagttgtagaaagagcccacagagatctaaaagacagattggcag
cttatcagggagattgtgaaaccgtagaagcagcccttagcctcgcattagtttctttaa
ataaaaaaagagggggaatagggggccatacaccatatgaaatatacctagaatcagaac
ataccaaataccaagaccaactagaacaacaattttcaaaacaaaaaattgaaaagtggt
gttacgtaaggaacagaagaaaggaatggaaaggaccctacaaagtgttgtgggacggag
acggggcagcagtaatagaggaagagggaaaaacagccttatatccacaccgtcatatgc
gcttcatcccccccccagattcagatatccaagatgggagttcgtga
5' End
3' End
NotesElectronic sequence not published.
Expression VectorpCligpRREpCIBvgpSyn
Assay MethodsFACS/Flourescence Microscopy (eGFP)FACS/Flourescence Microscopy (eGFP)
ResultsProtein expression levels were relatively high in the presence of REV. In the absence of REV, gag/pol expression was 10x less than that of the recoded gene.Gag/pol expression was 10x greater than that of the wild-type gene.
Protein Functionstructural genes
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodRecoding was performed using codons optimized for expression in human cells without changing amino
acid sequence.
Publication Author(s)Molina, R. P.; Ye, H. Q.; Brady, J.; Zhang, J.; Zimmerman, H.; Kaleko, M.; Luo, T.
Corresponding AuthorTianci Luo
Corresponding AddressAdvanced Vision Therapies, Inc., Rockville, MD 20850, USA.
Publication Year2004
Publication TitleA synthetic Rev-independent bovine immunodeficiency virus-based packaging construct
AbstractReplication competent lentivirus (RCL) has been the major safety concern associated with applications of lentivirus-based gene transfer systems for human gene therapy. Minimization and elimination of overlaps between the packaging and the transfer vector constructs are expected to reduce the potential to generate RCL. We previously developed second- and third-generation bovine immunodeficiency virus (BIV)-based gene transfer systems. However, some sequence homologies between the vector and gag/pol packaging constructs remained. In order to minimize the sequence homologies, we recoded gag/pol with codon usage optimized for expression in human cells in this report. Expression of the recoded gag/pol was Rev/RRE independent. Thus, RRE was eliminated from the packaging construct, thereby removing a 312 bp block of homology. In addition, recoding gag/pol minimized overall homologies between the packaging and transfer vector constructs. Vectors generated by the recoded packaging construct with a four plasmid system had titers greater than 1 x 10(6) transducing units per milliliter, equivalent to those of the earlier generation systems. The vectors were functional in vitro and efficiently transduced rat pigment epithelial cells in vivo. Generation of the synthetic packaging construct provides further advances to the safety of lentiviral vectors for clinical applications.
JournalHum Gene Ther. 15(9): 865-77.
SummaryThe authors wanted to create a lentivirus based gene transfer system with an improved safety profile. Continued use of viruses like BIV can eventually lead to replication competent lentivirus (RCL), a major safety concern considering the strategy is employed in human gene therapy. The authors recoded gag/pol to be Rev/RRE independent and removed RRE from the viral packaging construct. Removal of RRE eliminated a large stretch of homology between the transfer vector construct and packaging construct, which could potentially be introduced into target cells by homologous recombination or polymerase jumping during reverse transcription. Expression of gag/pol in the absence of REV was found to be 10 times better with the recoded gene than with the wild-type. Also, the risk of recombination resulting in a RCL was reduced, in theory, with the removal of 312 bps worth of homology. Thus the authors generated this efficient 4th generation lentivirus gene transfer system that should be safer than the 3rd generation.
Comments
Discussion
PubMed ID15353041
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site