Synthetic Gene DataBase
 

Synthetic Gene 253


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID223253
GenBank AccessionDQ369976
GenBank GI86753451
Gene NameHgp (HIV gag-pol)Hgpsyn
Gene Length (bp)42831
SpeciesHIV-1Homo sapiens
Strains03ZAPS124MB1T-REx 293, HeLa
CDSatgggtgcgagagcgtcagtattaagaggcgaaaaattagataaatgggaaaaaatcagg
ttaaggccagggggaaagaaatgctatatgataaaacacatagtatgggcaagcagggag
ctggaaagatttgcactcaactctggtcttttagaaacatcagaaggctgtaaacagata
ctaagtcagctacaaccagctcttaagacaggaacagaggaacttagatcattattcaac
acagtagcaactctctattgtgtacatgaaaggatagaggtacgagacaccaaggaagcc
ttagacaagatagaggaagaacaaaacaaaagtcaggcggctgacggaaaggtcagtcaa
aattatcctatagtgcagaatctccaagggcaaatggtacatcaggccatatcacctaga
actttgaatgcatgggtaaaagtaatagaggagaaggcttttagcccagaggtaataccc
atgtttacagcactatcagaagggtgcaccccacaagatttaaacaccatgttaaatacg
gtagggggacatcaagcagccatgcaaatgttaaaagataccatcaatgaagaggctgca
gaatgggatagattacatccagtccatgcggggcctattgcaccaggccagatgagagaa
ccaaggggaagtgacatagcaggaactactagtacccttcaggaacaaatagcatggatg
acaagtaacccacctgttccagtgggagatatctataaaagatggataattctggggtta
aataaaatagtgagaatgtatagccctgtcagcattttggacatgagacaagggccaaag
gaatccttcagagactatgtagatcggttctttaaatgtttaagagctgaacaagctaca
caagatgtaaaaaattggatgacagaaaccttgttggtccaaaatgcgaacccagattgt
aagaacattttaagagcattaggaccagcggctacattagaagaaatgatgacagcatgt
cagggagtgggaggacctagccacaaagcaagagtgttggctgaggcaatgagccaagca
aacagtacaaacatactgatgcagagaagtaattttaaaggccctaaaagaattgttaaa
tgcttcaactgtggcaaggaagggcacatagccagaaattgcagagcccctaggaaaaaa
ggctgttggaaatgtggaaaggaaggacaccaaatgaaagattgtactgagaggcaggct
aattttttagggaaaatttggccttcccacaagggaaggccagggaatttcctccagaac
agaccagtaccaacggccccaccagtagagccaacggccccaccagcagagagcttcagg
ttcgaggagacaaccccagctccgaagcaggagccgagagacagggaacccttaacttcc
ctcaaatcactctttggcagcgaccccttgttacaataaaggtagggggccaggtaaagg
aggctctcttagacacaggagcagatgatacagtattagaagacataaatttgccaggaa
aatggaaaccaaaaatgataggaggaattggaggttttattaaagtaagacaatatgatc
aagtgcctatagaaatttgtggaaaaaaggctataggttcagtattaatagggcctacac
ctgtcaacataattggaagaaacatgttgactcagcttggatgtacactaaattttccaa
ttagccccattgaaactgtaccagtaaaactgaagccaggaatggatggcccaaaggtta
aacaatggccattgacagaggagaaaataagggcattaacagcaatttgtgaagaaatgg
agaaggaaggaaaaattacaaaaattgggcctgaaaatccatataacactccaatatttg
ccataaaaaagaaggacagtactaagtggagaaaattagtagatttcagggaacttaata
aaagaactcaagacttttgggaagttcaattaggaataccacatccagcagggttaaaaa
agaaaaaatcagtgacagtactggatgtgggggatgcatatttttcagtgcctttagatg
aaggcttcagaaaatacactgcattcaccatacctagtataaacaatgaaacaccaggaa
ttagatatcaatataatgtactcccacagggatggaaaggatcaccagcaatatttcaaa
gtagcatgacaaaaattttagagccctttagagcaaaaaatccagaaatagtcatctatc
aatatatggatgacttgtatgtaggatctgacttagaaatagggcaacatagagcaaaaa
tagaggagttaagagaacatttattaaggtggggattcaccacaccagacaagaagcatc
agaaagaacccccatttctttggatggggtatgagctccatcctgacaagtggacagtac
agcctatacagctgccagaaaaagaaagctggactgtcaatgatatacagaagttagtgg
gaaaattaaactgggcaagtcagatttactcagggattaaagtaaagcaactttgtaaac
tccttaggggggccaaagcactaacagacgtagtaccactaactgaagaagcagaattag
aactggcagaaaacagggagattctaaaagaaccagtacatggagtatattatgacccat
caaaggatttaatagctgaaatacagaaacagggggctgaccaatggacatatcaaattt
accaagaaccacacaaaaatctgaaaacagggaagtatgcaaaaaggaggactgcccaca
ctaatgatgtaagacagttaacagaggcagtgcaaaaaataaccttggaaagcatagtaa
tatggggaaagacccctaaatttagactacccatccaaaaagagacatgggagagatggt
ggacagactattggcaagccacctggattcctgagtgggagtttgtcaatactcctcccc
tagtaaaattatggtaccagctggaaaaagaacccatagcaggagcagaaactttctatg
tagatggagcagccaatagggaaactaaaataggaaaagcagggtatgttactgacagag
gaaggcagaaaattgtttctataaatgaaacaacaaaccagaaggctgaattacaagcaa
ttcatctagctttgcaagattcagaatcagaagtaaacgtagtaacagattcacaatatg
cactaggaatcatccaagcacaaccagataggagtgagtcagagttagtcaaccaaataa
tagaacaattaataaaaaaggaaagggtctacctgtcatgggtaccagcacacaaaggaa
ttggaggaaatgagcaagtagataaattagtaagtagtggaatcaggaaagtactgtttc
tagatggaatagataaggctcaagaagagcatgaaaagtatcacagcaattggagagcaa
tggctagtgagtttaatctgccacccatagtagcaaaagaaatagtagccagctgtgata
aatgccagctaaaaggggaagccatacatggacaagtagactgtagtccggggatatggc
aattagattgtacacatttagaaggaaaaatcatcctggtagcagtccatgtagccagtg
gctacatagaagcagaggttatcccagcagaaacaggacaagaaacagcatactacatac
taaaattagcgggaagatggccagtcaaagtaatacatacagacaatggcagtaatttca
ccagtgctgcagttaaggcagcctgttggtgggcaggtatccaacaggaatttggaattc
cctacaatccccaaagtcagggagtagtagaatccatgaataaagaattaaagaaaatca
tagggcaagtaagagaccaagctgagcaccttaagacagcagtacaaatggcagtattca
ttcacaattataaaagaaaaggggggattggggggtacagtgcaggggaaagaataatag
acataatagcaacagacatacaaactaaagaattacaaaaacaaattataaaaattcaaa
attttcgggtttattacagagacagcagagaccctatttggaaaggaccagccaaactac
tctggaaaggtgaaggggcagtagtaatacaagataacagtgacataaaggtagtaccaa
ggaggaaagtaaaaatcattaaggactatggaaaacagatggcaggtgctgattgtgtgg
caggtagacaggatgaagattag
5' Endggccgatcgatgttgacattgattattgac
3' Endatgcggtgggctctatgggctagcagct
NotesWild-type genes were not tested in this paper.Emailed corresponding author for sequence 2/14/2006.
Expression VectorpShuttle-Hgpsyn
Assay MethodsSouthern Blot, Western Blot, Lentiviral titer
ResultsIn the presence of tetracycline, vector titers were about 100x higher than (-)Tet. Titers were on the order of 10^5 GFU/ml. HIV gag-pol expression was slightly higher than SIV gag-pol.
Protein Functionstructural genes
Recoding PurposeTo improve expression
Synthesized ByGeneart
Recoding Method“Codon-optimized versions of gag-pol were used, which reduces the risk of homologous recombination
and transfer of packing genes to target cells.”
Publication Author(s)Kuate, S.; Stefanou, D.; Hoffmann, D.; Wildner, O.; Uberla, K.
Corresponding AuthorKlaus Uberla
Corresponding AddressDepartment of Molecular and Medical Virology, Ruhr-University Bochum, D-44780 Bochum, Germany.
Publication Year2004
Publication TitleProduction of lentiviral vectors by transient expression of minimal packaging genes from recombinant adenoviruses
AbstractBACKGROUND: The potential of lentiviral vectors for clinical gene therapy has not yet been evaluated. One of the reasons is the cytotoxicity of lentiviral packaging genes which makes the generation of stable producer cell lines difficult. Therefore, a novel packaging system for lentiviral vectors based on transient expression of packaging genes by recombinant adenoviruses was developed. METHODS: Adenoviral vectors expressing VSV-G, codon-optimized HIV-1 gag-pol, and codon-optimized SIV gag-pol under the control of a tetracycline-regulatable promoter (adenoviral lenti-pack vectors) were constructed and the production levels of this vector system were evaluated. RESULTS: The generated adenoviral lenti-pack vectors could be grown to high titers when transgene expression was suppressed and no evidence for instabilities was obtained. Cells stably transfected with a SIV-based vector construct were converted into lentiviral vector producer cells by infection with the adenoviral lenti-pack vectors. Lentiviral vector titers obtained were as high as vector titers obtained by transient cotransfection experiments. A protocol was developed that allowed preparation of lentiviral vector stocks with undetectable levels of contaminating adenoviral lenti-pack vectors. CONCLUSIONS: The adenoviral lenti-pack vectors described should provide a convenient alternative approach to inducible packaging cell lines for large-scale lentiviral vector production. Transient expression of cytotoxic lentiviral packaging genes by the adenoviral lenti-pack vectors circumvents loss of titers during prolonged culture of packaging cell lines. The design of the adenoviral lenti-pack vectors should reduce the risk of transfer of packaging genes to target cells and at the same time provide flexibility with respect to the lentiviral vector constructs that can be packaged.
JournalJ Gene Med. 6(11): 1197-205.
SummaryThe authors wish to recode SIV and HIV genes in order to reduce the chance of packaging genes being transferred with genes of interest, the risk being a recombinant replication competent lentivirus. VSV-G, HIV-1 gag-pol, and SIV gag-pol were placed under the control of tetracycline-regulatable promoters and transfected into producer cells (T-REx 293), which would generate lentiviral vector particles that could enter target cells (HeLa). The authors did not make any mention of how the gene were recoded, simply that it was done by Geneart. Assays showed that vector production was strictly under the control of the tetracycline promoter.
CommentsThis paper is primarily about a gene transfer system and not codon optimization.
Discussion
PubMed ID15459964
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site