Synthetic Gene DataBase
 

Synthetic Gene 255


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID226255
GenBank AccessionNM_000737.2
GenBank GI15451751
Gene NamehCG (human chorionic gonadotropin)sc-hCG
Gene Length (bp)879804
SpeciesHomo sapiensDictyostelium discoideum
Strains
CDStccagcacctttctcgggtcacggcctcctcctggctcccaggaccccaccataggcaga
ggcaggccttcctacaccctactccctgtgcctccagcctcgactagtccctagcactcg
acgactgagtctctgaggtcacttcaccgtggtctccgcctcacccttggcgctggacca
gtgagaggagagggctggggcgctccgctgagccactcctgcgcccccctggccttgtct
acctcttgccccccgaggggttagtgtcgagctcaccccagcatcctatcacctcctggt
ggccttgccgcccccacaaccccgaggtataaagccaggtacacgaggcaggggacgcac
caaggatggagatgttccaggggctgctgctgttgctgctgctgagcatgggcgggacat
gggcatccaaggagccgcttcggccacggtgccgccccatcaatgccaccctggctgtgg
agaaggagggctgccccgtgtgcatcaccgtcaacaccaccatctgtgccggctactgcc
ccaccatgacccgcgtgctgcagggggtcctgccggccctgcctcaggtggtgtgcaact
accgcgatgtgcgcttcgagtccatccggctccctggctgcccgcgcggcgtgaaccccg
tggtctcctacgccgtggctctcagctgtcaatgtgcactctgccgccgcagcaccactg
actgcgggggtcccaaggaccaccccttgacctgtgatgacccccgcttccaggactcct
cttcctcaaaggcccctccccccagccttccaagcccatcccgactcccggggccctcgg
acaccccgatcctcccacaataaaggcttctcaatccgc
agatctatggagatgttccaggggctgctgctgttgctgctgctgagcatgggcgggaca
tggcatccaaggaaccgcttcggccacggtgccgccccatcaatgccacctggctgtgga
gaaggagggctgccccgtgtgcatcaccgtcaacaccaccatctgtgccggctactgccc
caccatgacccgcgtgctgcagggggtcctgccttccctgcctcaggtggtgtgcaacta
ccgcgatgtgcgcttcgagtccatccggctccctggctgcccgcgcggcgtgaaccccgt
ggtctcctacgccgtggctctcagctgtcaatgtgcactctgccgccgcagcaccactga
ctgcgggggtccaaggaccaccccttgacctgtgatagtggcagcggatctggatccggc
agtggagctcctcgcagcaccactgactgcgggggtcccaaggaccaccccttgacctgt
gatagtggcagcggatctggatccggcagtggagctcctgatgtgcaggattgcccagaa
tgcacgctacaggaaaacccattcttctcccagccgggtgccccaatacttcagtgcatg
ggctgctgcttctctagagcatatcccactccactaaggtccaagaagacgatgttggtc
caaaagaacgtcacctcagagtccacttgctgtagatctatggagatgttccaggggctg
ctgctgttgctgctgctgagcatgggcgggacatggcatccaaggaaccgcttcggccac
ggtgccgccccatcaatgccacctggctgtggagaaggagggctgccccgtgtgcatcac
cgtcaacaccaccatctgtgccggctactgccccaccatgacccgcgtgctgcagggggt
cctgccttccctgcctcaggtggtgtgcaactaccgcgatgtgcgcttcgagtccatccg
gctccctggctgcccgcgcggcgtgaaccccgtggtctcctacgccgtggctctcagctg
tcaatgtgcactctgccgccgcagcaccactgactgcgggggtccaaggaccaccccttg
acctgtgatagtggcagcggatctggatccggcagtggagctcctcgcagcaccactgac
tgcgggggtcccaaggaccaccccttgacctgtgatagtggcagcggatctggatccggc
agtggagctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccattcttc
tcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctagagcatatccc
actccactaaggtccaagaagacgatgttggtccaaaagaacgtcacctcagagtccact
tgctgtgtagctaaatcatataacagggtcacagtaatggggggtttcaaagtggagaac
cacacggcgtgccactgcagtacttgttattatcacaaatcttaaatgtttagatct
5' Endagatct
3' Endatgtttagatct
Notes
Expression VectorPCR2.1 TOPO, pSP72
Assay Methodssandwich-type ELISAsandwich-type ELISA
ResultsBy optimizing the first 5-17 codons (cluster 1), the expression increases 4-5 fold. However, further optimization of either cluster 2 or 3 does not increase the expression. Changing the 5’ sequence also did not increase the optimization a great deal. TBy optimizing the first 5-17 codons (cluster 1), the expression increases 4-5 fold. However, further optimization of either cluster 2 or 3 does not increase the expression. Changing the 5’ sequence also did not increase the optimization a great deal. T
Protein FunctionProduced by the placenta to stimulate ovaries to produce steroids that maintain pregnancy
Recoding PurposeTo improve expression by optimizing codon use
Synthesized ByAuthors
Recoding MethodNon-optimal codons were identified and grouped into three clusters. Optimized were created using
PCR with mutant oligonucleotides and site-specific mutagenesis and other DNA synthesis approaches.
The clusters were then combine with other clusters or the wildtype strain.
Publication Author(s)Vervoort, E. B.; van Ravestein, A.; van Peij, N. N.; Heikoop, J. C.; van Haastert, P. J.; Verheijden, G. F.; Linskens, M. H.
Corresponding Author
Corresponding AddressCell Engineering Facility GBB, University of Groningen, Nijenborgh 4, 9747 AG Groningen, The Netherlands.
Publication Year2000
Publication TitleOptimizing heterologous expression in dictyostelium: importance of 5' codon adaptation
AbstractExpression of heterologous proteins in Dictyostelium discoideum presents unique research opportunities, such as the functional analysis of complex human glycoproteins after random mutagenesis. In one study, human chorionic gonadotropin (hCG) and human follicle stimulating hormone were expressed in Dictyostelium. During the course of these experiments, we also investigated the role of codon usage and of the DNA sequence upstream of the ATG start codon. The Dictyostelium genome has a higher AT content than the human, resulting in a different codon preference. The hCG-beta gene contains three clusters with infrequently used codons that were changed to codons that are preferred by Dictyostelium. The results reported here show that optimizing the first 5-17 codons of the hCG gene contributes to 4- to 5-fold increased expression levels, but that further optimization has no significant effect. These observations suggest that optimal codon usage contributes to ribosome stabilization, but does not play an important role during the elongation phase of translation. Furthermore, adapting the 5'-sequence of the hCG gene to the Dictyostelium 'Kozak'-like sequence increased expression levels approximately 1.5-fold. Thus, using both codon optimization and 'Kozak' adaptation, a 6- to 8-fold increase in expression levels could be obtained for hCG.
JournalNucleic Acids Res. 28(10): 2069-74.
SummaryResearchers took human chorionic gonadotropin and optimized some of the codons, then inserted into the soil amoeba, Dictyostelium discoideum. It was optimized with codons preferred by Dictyostelium discoideum. The codons were grouped into clusters. Six different constructs were synthesized and placed in the soil amoeba. Also the researchers changed the 5’ sequence for the hCG. It was found that optimizing only the first 5-17 codons significantly increases the expression of the protein. Changing the 5’ sequence did not significantly increase the expression, however. Using both techniques the expression levels increased ~6 to 8 fold.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=617
PubMed ID10773074
Submitter NameNolan, Katie
Submitter Address1000 Hilltop Cr., Baltimore, Maryland 21250, U.S.A
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site