Synthetic Gene DataBase
 

Synthetic Gene 256


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID227256
GenBank AccessionNM_001275.2
GenBank GI10800418
Gene NameCHGAGST-VAS
Gene Length (bp)1987193
SpeciesHomo sapiensEscherichia coli
Strains
CDSgctgccaccgctcctgccactgcagtgctcgagccccgtgcaggggagcttgcgggagga
tcgaccgacagacggacgcacgccgaggcactgcgcccccagccccgcgccggtgccacc
gcagcccgaccccggccgccagtccagccgcccctcgcccggtgcctaggtgcccggccc
cacaccgccagctgctcggcgcccgggtccgccatgcgctccgccgctgtcctggctctt
ctgctctgcgccgggcaagtcactgcgctccctgtgaacagccctatgaataaaggggat
accgaggtgatgaaatgcatcgttgaggtcatctccgacacactttccaagcccagcccc
atgcctgtcagccaggaatgttttgagacactccgaggagatgaacggatcctttccatt
ctgagacatcagaatttactgaaggagctccaagacctcgctctccaaggcgccaaggag
agggcacatcagcagaagaaacacagcggttttgaagatgaactctcagaggttcttgag
aaccagagcagccaggccgagctgaaagaggcggtggaagagccatcatccaaggatgtt
atggagaaaagagaggattccaaggaggcagagaaaagtggtgaagccacagacggagcc
aggccccaggccctcccggagcccatgcaggagtccaaggctgaggggaacaatcaggcc
cctggggaggaagaggaggaggaggaggaggccaccaacacccaccctccagccagcctc
cccagccagaaatacccaggcccacaggccgagggggacagtgagggcctctctcagggt
ctggtggacagagagaagggcctgagtgcagagccagggtggcaggcaaagagagaagag
gaggaggaggaggaggaggaggctgaggctggagaggaggctgtccccgaggaagaaggc
cccactgtagtgctgaacccccacccgagccttggctacaaggagatccggaaaggcgag
agtcggtcggaggctctggctgtggatggagctgggaagcctggggctgaggaggctcag
gaccccgaagggaagggagaacaggagcactcccagcagaaagaggaggaggaggagatg
gcagtggtcccgcaaggcctcttccggggtgggaagagcggagagctggagcaggaggag
gagcggctctccaaggagtgggaggactccaaacgctggagcaagatggaccagctggcc
aaggagctgacggctgagaagcggctggaggggcaggaggaggaggaggacaaccgggac
agttccatgaagctctccttccgggcccgggcctacggcttcaggggccctgggccgcag
ctgcgacgaggctggaggccatcctcccgggaggacagccttgaggcgggcctgcccctc
caggtccgaggctaccccgaggagaagaaagaggaggagggcagcgcaaaccgcagacca
gaggaccaggagctggagagcctgtcggccattgaagcagagctggagaaagtggcccac
cagctgcaggcactacggcggggctgagacaccggctggcagggctggccccagggcacc
ctgtggccctggctctgctgtccccttggcaggtcctggccagatggcccggacgctgct
tccggtagggaggcagcctccagcctgcccaagcccaggccaccctatcgccccctacgc
gccttgtctcctactcctgactcctacctgccctggaacatcctttgcagggcagcccca
caactttaaacattgacgattccttctctgaacacaggcagctttctagaagtttccctt
cctccatcctatccactgggcacaactgcaataacttctgaccttttggtgaaagctgag
aactcctgactgtaacatattctgtatgaactttatctaaagaaaaataaatctgttctg
ggctct
atgactgacatgcacggtgactctgaatacaacatcatgtttggtccagacatctgcggc
ccgggcaccaaaaaagttcacgtaatcttcaactacaaaggcaagaacgttctgatcaac
aaagacatccgttgcaaggatgatgaatttacacacctgtacacactgattgttcgtcca
gacaactaaatga
5' End
3' End
NotesThis gene was not actually used in the experiment. The sequence is for the gene chromogranin, vasostatin (a peptide) is encoded in the sequence.The coding sequence only includes the optimized of VAS gene and is not the full sequence used in the study. (full sequence was not given)
Expression VectorpALEX
Assay MethodsSDS-page, Chromatography, Western BlotChromatography, Western Blot, gel filtraion, SDS-Page
ResultsFirst time useable and intact vasostatin was obtained, 7.2 mg from a 1 L culture.
Protein Functionunknown
Recoding PurposeTo study the anti-angiogenesis properties of vasostatin and for purification of vasostatin for other studies.
Synthesized ByAuthors
Recoding MethodOligonucleotides were synthesized (25-30 bp). Then the oligonucleotides were diluted and
phosphorylated; the gaps were then filled with Klenow large fragment and treated with ligase for
nicks. After a PCR, the gene was inserted into the plasmid pALEX
Publication Author(s)Sun, Q. M.; Cao, L.; Fang, L.; Chen, C.; Dai, J.; Chen, L. L.; Hua, Z. C.
Corresponding Author
Corresponding AddressThe State Key Laboratory of Pharmaceutical Biotechnology, Department of Biochemistry, College of Life Sciences, Nanjing University, Nanjing 210093, PR China.
Publication Year2005
Publication TitleExpression, purification of human vasostatin120-180 in Escherichia coli, and its anti-angiogenic characterization
AbstractAccording to codon preference of Escherichia coli, the optimized coding sequence of human vasostatin120-180aa (VAS) was obtained by chemical synthesis and molecular cloning methods. Using PCR and enzyme digestion, the full encoding sequence for VAS was cloned into the E. coli expression vector pALEX and expressed as a GST fusion protein in BL21 (DE3) strain. GST-VAS protein approximately accounted for 45% of the total bacterial proteins. Most of target protein existed in inclusion body. To improve the solubility of GST-VAS, the contribution of low temperature and molecular chaperone co-expression to the solubility of GST-VAS was tested. The results showed that co-expression with chaperons, TF and GroES/GroEL, and low expression temperature cooperatively improved the solubility of GST-VAS from 10 to 85%, and the yield of soluble GST-VAS was sixfold increased. When purified by GST affinity chromatography, 50 mg GST-VAS was obtained with purity over 85% from 1 L culture. Intact VAS was released by enterokinase digestion and further purified by Sephadex G50 gel filtration chromatography. About 7.2 mg intact homogeneous VAS protein was finally produced from 1L bacterial culture. The identity of GST-VAS and VAS was validated by Western blotting analysis. Recombinant VAS protein displayed distinct inhibition of endothelial cell proliferation and anti-angiogenic activity by chick embryo chorioallantoic membrane assay.
JournalProtein Expr Purif. 39(2): 288-95.
SummaryWithin a human gene, a peptide called vasostatin has been shown to have anti-angiogenesis effects. Researchers took this part of a gene and optimized the codons of the vasostatin (VAS). This was done through ten oligonucleotides that were chemically synthesized, phosphorylated, annealed, Klenow fill-in, ligased and PCR reactions. Combining this with glutathione S-transferase (GST) fusion protein from E. coli, it was placed in a plasmid, pALEX. Through various assays including SDS-PAGE and Western blot, the vasostatin was purified. It was found that lower temperature and a co-expression chaperone increase the yield of the vasostatin. Using the purified vasostatin, it was proven, in doses, to inhibit the angiogenesis in a chick embryo.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=618
PubMed ID15642481
Submitter NameNolan, Katie
Submitter Address1000 Hilltop Cr., Baltimore, Maryland 21250, U.S.A
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site