Synthetic Gene DataBase
 

Synthetic Gene 258


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID228258
GenBank AccessionV00296AY192357
GenBank GI4190137780058
Gene NameLacZLacZnls7co
Gene Length (bp)30693090
SpeciesE. coliMus musculus; Homo sapiens; Chinese Hamster
StrainsEC 3.2.1.23NIH3T3; HeLa, A549; CHO-K1
CDSatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgtt
acccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagag
gcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcc
tggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgaggcc
gatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctacacc
aacgtaacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggt
tgttactcgctcacatttaatgttgatgaaagctggctacaggaaggccagacgcgaatt
atttttgatggcgttaactcggcgtttcatctgtggtgcaacgggcgctgggtcggttac
ggccaggacagtcgtttgccgtctgaatttgacctgagcgcatttttacgcgccggagaa
aaccgcctcgcggtgatggtgctgcgttggagtgacggcagttatctggaagatcaggat
atgtggcggatgagcggcattttccgtgacgtctcgttgctgcataaaccgactacacaa
atcagcgatttccatgttgccactcgctttaatgatgatttcagccgcgctgtactggag
gctgaagttcagatgtgcggcgagttgcgtgactacctacgggtaacagtttctttatgg
cagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaattatcgatgag
cgtggtggttatgccgatcgcgtcacactacgtctgaacgtcgaaaacccgaaactgtgg
agcgccgaaatcccgaatctctatcgtgcggtggttgaactgcacaccgccgacggcacg
ctgattgaagcagaagcctgcgatgtcggtttccgcgaggtgcggattgaaaatggtctg
ctgctgctgaacggcaagccgttgctgattcgaggcgttaaccgtcacgagcatcatcct
ctgcatggtcaggtcatggatgagcagacgatggtgcaggatatcctgctgatgaagcag
aacaactttaacgccgtgcgctgttcgcattatccgaaccatccgctgtggtacacgctg
tgcgaccgctacggcctgtatgtggtggatgaagccaatattgaaacccacggcatggtg
ccaatgaatcgtctgaccgatgatccgcgctggctaccggcgatgagcgaacgcgtaacg
cgaatggtgcagcgcgatcgtaatcacccgagtgtgatcatctggtcgctggggaatgaa
tcaggccacggcgctaatcacgacgcgctgtatcgctggatcaaatctgtcgatccttcc
cgcccggtgcagtatgaaggcggcggagccgacaccacggccaccgatattatttgcccg
atgtacgcgcgcgtggatgaagaccagcccttcccggctgtgccgaaatggtccatcaaa
aaatggctttcgctacctggagagacgcgcccgctgatcctttgcgaatacgcccacgcg
atgggtaacagtcttggcggtttcgctaaatactggcaggcgtttcgtcagtatccccgt
ttacagggcggcttcgtctgggactgggtggatcagtcgctgattaaatatgatgaaaac
ggcaacccgtggtcggcttacggcggtgattttggcgatacgccgaacgatcgccagttc
tgtatgaacggtctggtctttgccgaccgcacgccgcatccagcgctgacggaagcaaaa
caccagcagcagtttttccagttccgtttatccgggcaaaccatcgaagtgaccagcgaa
tacctgttccgtcatagcgataacgagctcctgcactggatggtggcgctggatggtaag
ccgctggcaagcggtgaagtgcctctggatgtcgctccacaaggtaaacagttgattgaa
ctgcctgaactaccgcagccggagagcgccgggcaactctggctcacagtacgcgtagtg
caaccgaacgcgaccgcatggtcagaagccgggcacatcagcgcctggcagcagtggcgt
ctggcggaaaacctcagtgtgacgctccccgccgcgtcccacgccatcccgcatctgacc
accagcgaaatggatttttgcatcgagctgggtaataagcgttggcaatttaaccgccag
tcaggctttctttcacagatgtggattggcgataaaaaacaactgctgacgccgctgcgc
gatcagttcacccgtgcaccgctggataacgacattggcgtaagtgaagcgacccgcatt
gaccctaacgcctgggtcgaacgctggaaggcggcgggccattaccaggccgaagcagcg
ttgttgcagtgcacggcagatacacttgctgatgcggtgctgattacgaccgctcacgcg
tggcagcatcaggggaaaaccttatttatcagccggaaaacctaccggattgatggtagt
ggtcaaatggcgattaccgttgatgttgaagtggcgagcgatacaccgcatccggcgcgg
attggcctgaactgccagctggcgcaggtagcagagcgggtaaactggctcggattaggg
ccgcaagaaaactatcccgaccgccttactgccgcctgttttgaccgctgggatctgcca
ttgtcagacatgtataccccgtacgtcttcccgagcgaaaacggtctgcgctgcgggacg
cgcgaattgaattatggcccacaccagtggcgcggcgacttccagttcaacatcagccgc
tacagtcaacagcaactgatggaaaccagccatcgccatctgctgcacgcggaagaaggc
acatggctgaatatcgacggtttccatatggggattggtggcgacgactcctggagcccg
tcagtatcggcggaattccagctgagcgccggtcgctaccattaccagttggtctggtgt
caaaaataa
atgcccaagaagaagaggaaggtgatcaccgactccctggccgtggtgctgcagcgccgc
gactgggagaaccccggcgtgacccagctgaaccgcctggccgcccacccccccttcgcc
tcctggcgcaactccgaggaggcccgcaccgaccgcccctcccagcagctgcgctccctg
aacggcgagtggcgcttcgcctggttccccgcccccgaggccgtgcccgagtcctggctg
gagtgcgacctgcccgaggccgacaccgtggtggtgccctccaactggcagatgcacggc
tacgacgcccccatctacaccaacgtgacctaccccatcaccgtgaacccccccttcgtg
cccaccgagaaccccaccggctgctactccctgaccttcaacgtggacgagtcctggctg
caggagggccagacccgcatcatcttcgacggcgtgaactccgccttccacctgtggtgc
aacggccgctgggtgggctacggccaggactcccgcctgccctccgagttcgacctgtcc
gccttcctgcgcgccggcgagaaccgcctggccgtgatggtgctgcgctggtccgacggc
tcctacctggaggaccaggacatgtggcgcatgtccggcatcttccgcgacgtgtccctg
ctgcacaagcccaccacccagatctccgacttccacgtggccacccgcttcaacgacgac
ttctcccgcgccgtgctggaggccgaggtgcagatgtgcggcgagctgcgcgactacctg
cgcgtgaccgtgtccctgtggcagggcgagacccaggtggcctccggcaccgcccccttc
ggcggcgagatcatcgacgagcgcggcggctacgccgaccgcgtgaccctgcgcctgaac
gtggagaaccccaagctgtggtccgccgagatccccaacctgtaccgcgccgtggtggag
ctgcacaccgccgacggcaccctgatcgaggccgaggcctgcgacgtgggcttccgcgag
gtgcgcatcgagaacggcctgctgctgctgaacggcaagcccctgctgatccgcggcgtg
aaccgccacgagcaccaccccctgcacggccaggtgatggacgagcagaccatggtgcag
gacatcctgctgatgaagcagaacaacttcaacgccgtgcgctgctcccactaccccaac
caccccctgtggtacaccctgtgcgaccgctacggcctgtacgtggtggacgaggccaac
atcgagacccacggcatggtgcccatgaaccgcctgaccgacgacccccgctggctgccc
gccatgtccgagcgcgtgacccgcatggtgcagcgcgaccgcaaccacccctccgtgatc
atctggtccctgggcaacgagtccggccacggcgccaaccacgacgccctgtaccgctgg
atcaagtccgtggacccctcccgccccgtgcagtacgagggcggcggcgccgacaccacc
gccaccgacatcatctgccccatgtacgcccgcgtggacgaggaccagcccttccccgcc
gtgcccaagtggtccatcaagaagtggctgtccctgcccggcgagacccgccccctgatc
ctgtgcgagtacgcccacgccatgggcaactccctgggcggcttcgccaagtactggcag
gccttccgccagtacccccgcctgcagggcggcttcgtgtgggactgggtggaccagtcc
ctgatcaagtacgacgagaacggcaacccctggtccgcctacggcggcgacttcggcgac
acccccaacgaccgccagttctgcatgaacggcctggtgttcgccgaccgcaccccccac
cccgccctgaccgaggccaagcaccagcagcagttcttccagttccgcctgtccggccag
accatcgaggtgacctccgagtacctgttccgccactccgacaacgagctgctgcactgg
atggtggccctggacggcaagcccctggcctccggcgaggtgcccctggacgtggccccc
cagggcaagcagctgatcgagctgcccgagctgccccagcccgagtccgccggccagctg
tggctgaccgtgcgcgtggtgcagcccaacgccaccgcctggtccgaggccggccacatc
tccgcctggcagcagtggcgcctggccgagaacctgtccgtgaccctgcccgccgcctcc
cacgccatcccccacctgaccacctccgagatggacttctgcatcgagctgggcaacaag
cgctggcagttcaaccgccagtccggcttcctgtcccagatgtggatcggcgacaagaag
cagctgctgacccccctgcgcgaccagttcacccgcgcccccctggacaacgacatcggc
gtgtccgaggccacccgcatcgaccccaacgcctgggtggagcgctggaaggccgccggc
cactaccaggccgaggccgccctgctgcagtgcaccgccgacaccctggccgacgccgtg
ctgatcaccaccgcccacgcctggcagcaccagggcaagaccctgttcatctcccgcaag
acctaccgcatcgacggctccggccagatggccatcaccgtggacgtggaggtggcctcc
gacaccccccaccccgcccgcatcggcctgaactgccagctggcccaggtggccgagcgc
gtgaactggctgggcctgggcccccaggagaactaccccgaccgcctgaccgccgcctgc
ttcgaccgctgggacctgcccctgtccgacatgtacaccccctacgtgttcccctccgag
aacggcctgcgctgcggcacccgcgagctgaactacggcccccaccagtggcgcggcgac
ttccagttcaacatctcccgctactcccagcagcagctgatggagacctcccaccgccac
ctgctgcacgccgaggagggcacctggctgaacatcgacggcttccacatgggcatcggc
ggcgacgactcctggtccccctccgtgtccgccgagttccagctgtccgccggccgctac
cactaccagctggtgtggtgccagaagtag
5' End
3' End
Notes
Expression VectorpcDNA3.1pcDNA3.1
Assay MethodsX-gal staining, Northern BlotX-gal staining, Northern Blot
Results1.89+/-0.15 ng Beta-gal per mg total cell proteinmRNA levels were approximately twice as high as wild-type LacZ. The resulting protein expression was approximately 15 fold higher than the wild-type gene as estimated from X-gal staining. The protein product localized to the nucleus successfully.
Protein Functionreporter gene
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe Beta-gal protein sequence was back-translated using optimal codon usage for high level mammalian
gene expression. A Kozak translational initiation consensus sequence was placed in front of the
coding sequence. A 7 peptide nuclear localization signal w
Publication Author(s)Anson DS, Limberis M.
Corresponding AuthorDonald S. Anson
Corresponding AddressDepartment of Chemical Pathology, Women's and Children's Hospital, 72 King William Road, North Adelaide, SA 5006, Australia.
Publication Year2004
Publication TitleAn improved beta-galactosidase reporter gene.
AbstractThe coding sequence for the E. coli beta-galactosidase gene was codon-optimised for expression in mammalian cells. When expressed in mammalian cells the codon-optimised gene results in the expression of beta-galactosidase at levels 15-fold higher than those resulting from an analogous construct containing the native E. coli gene sequence. RNA analysis suggests the enhancement of beta-galactosidase expression is due both to enhanced transcript stability and increased translational efficiency. When used in a lentiviral construct the codon-optimised gene results in an approximately five-fold increase in apparent titre, as determined by 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside staining, in comparison to an analogous construct containing the native E. coli gene. Southern blot analysis shows this is due to an increased efficiency of detection of transduced cells. In addition, codon-optimisation results in the elimination of several cryptic splice acceptor sites that are present in the native E. coli gene sequence. In a lentiviral vector containing a 5' splice donor the use of the codon-optimised gene in place of the native E. coli beta-galactosidase gene resulted in increased amounts of un-spliced, full-length genomic RNA. Therefore, as a marker/reporter gene in mammalian cells the codon-optimised beta-galactosidase gene has a number of advantages over the native E. coli gene sequence. A variant of the codon-optimised beta-galactosidase gene sequence that includes an effective nuclear localisation signal was also made.
JournalJ Biotechnol.. 108(1): 17-30.
SummaryThe authors wished to produce an improved Beta-gal reporter for use in mammalian cells. Wild-type Beta-gal activity was disappointingly low and required prolonged incubation with X-gal. The authors approached the problem with by performing codon optimization on the LacZ gene. The Beta-gal protein sequence was back-translated using optimal codon usage for high level mammalian gene expression. A Kozak translational initiation consensus sequence was placed in front of the coding sequence. Northern blot analysis showed that higher mRNA resulted from recoded LacZ. Ultimately, codon optimization improved Beta-galactosidase expression by 15 fold, as a consequence of both enhanced mRNA stability and translational efficiency. The authors also produced protein 2 variants that localized to the nucleus successfully.
Comments
Discussion
PubMed ID14741766
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site