Synthetic Gene DataBase
 

Synthetic Gene 260


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID229260
GenBank AccessionX61596
GenBank GI59478
Gene NamewtNS3/4AcoNS3/4A
Gene Length (bp)25711
SpeciesHepatitis C virusHomo sapiens; Mus musculus
StrainsHepG2; BALB/c
CDSatggggagggagatacttctgggaccggccgatggtttcagagagcagggatggcgactc
cttgcgcccatcacggcctactcccaacagacgcggggcctatttggctgcatcgtcact
agtctcacaggtcgggacaagaaccaggtcgaaggggaggctcaggtggtttccaccgca
acgcaatctttcttggcgacctgtgtcaacggcgtgtgttggactgtttaccatggcgcc
ggctcaaagaccctagccggcccaaaggggccaatcaaccaaatgtacactaatgtggat
caggacctcgtcggctggcaggcgccctccggggcggcttccttgacaccgtgcacctac
ggcagctcggacctttacttggtcacgaggcatgctgatgtcattccggtgcgccggcgg
ggcgacagcagggggagtctactttcccccaggcccgtctcctacttgaagggctcttcc
ggtggtccactgctctgcccctcggggcacgctgtgggcatcttccgggctgctgtgtgc
acccggggggttgcgaaggcggtggacttcatacccgttgagtctatggaaactaccatg
cggtctccggtcttcacggataattcttctcccccggccgtaccgcagacattccaagtg
gcccatctacatgctcccactggcagcggcaagagcactaaggtgccggctgcatacgca
gcccaagggtacaaggtactcgtcctgaacccgtccgttgccgccaccttgggttttggg
gcatacatgtccaaggcacatggtgttgaccctaacatcagtactggggtaaggaccatc
accacgggcgcccctatcacgtactccacctacggcaagttccttgccgacggtggttgc
tccgggggcgcctatgacatcataatatgtgacgagtgccattcaactgactcgacttct
atcttaggcatcggcacggtcctggaccaagcggagacggctggagcgcggctcgtcgtg
ctcgccgccgctacgcctccgggatcggtcaccgtgccacatcccaacattgaggaggtg
gccttgcctaacaccggagagattcccttctatggcaaagccatccccctcgagaccatc
aagggggggaggcatctcatcttctgccattccaagaagaagtgtgatgagctcgctgca
aagctgtcggccctcggggtcaatgctgtagcgtactaccggggccttgatgtgtccgtc
ataccgacaagcggagacgtcgttgtcgtggcaacagacgccctaatgacaggctacacc
ggtgactttgattcagtgatcgactgtaatacatgtgtcacccagacagtcgacttcagc
ttggaccctaccttcaccattgagacgacaacgctgccccaagacgcggtgtcgcgctca
caacggcgaggcagaactggcaggggtagagggggcatatacaggtttgtgactccaggg
gaacggccttcgggtatgttcgattcttcggtcctatgtgagtgctatgacgcgggctgt
gcttggtacgagctcacgcccgcagtgacctcggttaggctgcgggcttacctaaataca
ccagggttgcccgtctgccaggtccacctggagttctgggagagcgtctttacaggcctc
acccacatagatgcccacttcttgtcccagactaagcaggcaggagagaacttcccctac
ctggtggcataccaggccacagtgtgcgccagggcccaggccccacctccatcgtgggat
caaatgtggaagtgtctcatacggctaaagcctacgctgcacgggccaacacccctgttg
tataggctaggagccgtccaaaacgaggtcaccctcacacaccccataaccaaattcatc
atggcatgcatgtcggctgatctagaggtcgtcaccagcacctgggtgctggtaggcgga
gtcctcgcagctctggccgcgtactgcctgacaacgggcagcgtggttattgtgggcagg
atcatcttgtccgggaggccggctatcattcctgacagggaagtcctctaccaggagttt
gatgagatggaggagtgcgcctcacaccttccttacatcgaacaaggaatgcagctcgcc
gagcaattcaagcagaaggcgctcgggctgctgcaaacagcctccaagcaagcggaggct
gctgctcctgtggtagagtccaagtggcaagcccttgaggccttctgggcgaagcacatg
tggaacttcatcagcgggatacagtatctagcaggcttgtccaccctgcctggaaacccc
gcaatagtatcactgatggcattcacagcctctatcactagcccgctcaccacccaacat
accctcctgtttaacatcttagggggatgggtggccgcccaactcgccccccccagcgct
gcttcagccttcgtgggcgccggcatcgctggcgcggctgttggcagcataggccttggg
aaggtgcttgtggacatcctggcgggttatggagcaggggtggcaggcgca
5' End
3' End
NotesEmailed corresponding author for recoded gene sequence 2/19/2006.
Expression VectorpVAX-1pVAX-1
Assay MethodsSDS-PAGE, Western blot, flow cytometry, immunofluorescenceSDS-PAGE, Western blot, flow cytometry, immunofluorescence
ResultsOverall, wtNS3/4A induced a much weaker immune response when inserted by gene gun than coNS3/4A. However, when vectors were inserted using SFV, the levels of wtNS3/4A were as high as that of coNS3/4A inserted by gene gun.This recoded gene induced much high IgG levels than the wild-type gene, but not quite as much as that of the SFV inserted wild-type gene.
Protein FunctionCTL epitope
Recoding PurposeTo improve expression
Synthesized ByRetrogen Inc.
Recoding MethodAuthors adjusted the codons usage within the gene to match the codons most often used by human
cells.
Publication Author(s)Frelin, L.; Ahlen, G.; Alheim, M.; Weiland, O.; Barnfield, C.; Liljestrom, P.; Sallberg, M.
Corresponding AuthorM. Sallberg
Corresponding AddressDivision of Clinical Virology, Karolinska Institutet at Huddinge University Hospital, Stockholm, Sweden.
Publication Year2004
Publication TitleCodon optimization and mRNA amplification effectively enhances the immunogenicity of the hepatitis C virus nonstructural 3/4A gene
AbstractWe have recently shown that the NS3-based genetic immunogens should contain also hepatitis C virus (HCV) nonstructural (NS) 4A to utilize fully the immunogenicity of NS3. The next step was to try to enhance immunogenicity by modifying translation or mRNA synthesis. To enhance translation efficiency, a synthetic NS3/4A-based DNA (coNS3/4A-DNA) vaccine was generated in which the codon usage was optimized (co) for human cells. In a second approach, expression of the wild-type (wt) NS3/4A gene was enhanced by mRNA amplification using the Semliki forest virus (SFV) replicon (wtNS3/4A-SFV). Transient tranfections of human HepG2 cells showed that the coNS3/4A gene gave 11-fold higher levels of NS3 as compared to the wtNS3/4A gene when using the CMV promoter. We have previously shown that the presence of NS4A enhances the expression by SFV. Both codon optimization and mRNA amplification resulted in an improved immunogenicity as evidenced by higher levels of NS3-specific antibodies. This improved immunogenicity also resulted in a more rapid priming of cytotoxic T lymphocytes (CTLs). Since HCV is a noncytolytic virus, the functionality of the primed CTL responses was evaluated by an in vivo challenge with NS3/4A-expressing syngeneic tumor cells. The priming of a tumor protective immunity required an endogenous production of the immunogen and CD8+ CTLs, but was independent of B and CD4+ T cells. This model confirmed the more rapid in vivo activation of an NS3/4A-specific tumor-inhibiting immunity by codon optimization and mRNA amplification. Finally, therapeutic vaccination with the coNS3/4A gene using gene gun 6-12 days after injection of tumors significantly reduced the tumor growth in vivo. Codon optimization and mRNA amplification effectively enhances the overall immunogenicity of NS3/4A. Thus, either, or both, of these approaches should be utilized in an NS3/4A-based HCV genetic vaccine.
JournalGene Ther. 11(6): 522-33.
SummaryThe authors wished to use the hepatitis C virus 3/4A gene to induce a strong immune response. The improved immunogenicity would result priming of CTLs. To improve the response, the authors used two different methods. First, they recoded the wild-type NS3/4A gene and exposed cells to both genes using a gene gun. Codon optimized NS3/4A was recoded to optimize usage for human cells. Second, cells were transfected with the wild-type gene using heavy exposure to Semliki forest virus (SFV) vectors, effectively increasing mRNA levels and overall expression. IgG levels were found for all trials. Overall, wtNS3/4A induced a much weaker immune response when inserted by gene gun than coNS3/4A. However, when vectors were inserted using SFV, the levels of wtNS3/4A were as high as that of coNS3/4A inserted by gene gun. From these results, authors concluded that both codon optimization and mRNA amplification were effective in enhancing overall immunogenicity. The authors also determined that endogenous production of NS3/4A was need to prime protective CTLs in vivo.
Comments
Discussion
PubMed ID14999224
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site