Synthetic Gene DataBase
 

Synthetic Gene 261


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID230261
GenBank Accession
GenBank GI
Gene NameGP (α-glucan phosphorylase)GP-syn
Gene Length (bp)25172517
SpeciesSolanum tuberosumAspergillus niger
StrainsND48prt42A122A
CDSatggaaggtggtgcaaaatcgaatgatgtatcagcagcacctattgctcaaccactttct
gaagaccctactgacattgcatctaatatcaagtatcatgctcaatatactcctcatttt
tctcctttcaagtttgagccactacaagcatactatgctgctactgctgacagtgttcgt
gatcgcttgatcaaacaatggaatgacacctatcttcattatgacaaagttaatccaaag
caaacatactacttatcaatggagtatctccaggggcgagctttgacaaatgcagttgga
aacttagacatccacaatgcatatgctgatgctttaaacaaactgggtcagcagcttgag
gaggtcgttgagcaggaaaaagatgcagcattaggaaatggtggtttaggaaggctcgct
tcatgctttcttgattccatggccacattgaaccttccagcatggggttatggcttgagg
tacagatatggactttttaagcagcttatcacaaaggctgggcaagaagaagttcctgaa
gattggttggagaaatttagtccctgggaaattgtaaggcatgatgttgtctttcctatc
aggttttttggtcatgttgaagtcctcccttctggctcgcgaaaatgggttggtggagag
gtcctacaggctcttgcatatgatgtgccaattccaggatacagaactaaaaacactaat
agtcttcgtctctgggaagccaaagcaagctctgaggatttcaacttgtttctgtttaat
gatggacagtatgatgctgctgcacagcttcattctagggctcagcagatttgtgctgtt
gtctaccctggggatgctacagagaatggaaaactcttacggctaaagcaacaatttttt
ctgtgcagtgcatcgcttcaggatattattgccagattcaaagagagagaagatggaaag
ggttctcaccagtggtctgaattccccaagaaggttgcgatacaactaaatgacacacat
ccaactcttacgattccagagctgatgcggttgctaatggatgatgaaggacttgggtgg
gatgaatcttggaatatcactactaggacaattgcctatacgaatcatacagtcctacct
gaagcacttgaaaaatggtctcaggcagtcatgtggaagctccttcctagagatatggaa
atcattgaagaaattgacaaacggtttgttgctacaataatgtcagaaagacctgatctt
gagaataagatgcctagcatgcgcattttggatcacaacgccacaaaacctgttgtgcat
atggctaacttgtgtgttgtctcttcacataccgtaaatggtgttgcccagctgcatagt
gacatcctgaaggctgagttatttgctgattatgtctctgtatggcccaccaagttccag
aataagaccaatggtataactcctcgtaggtggatccgattttgtagtcctgagctgagt
catataattaccaagtggttaaaaacagatcaatgggtgacgaacctcgaactgcttgct
aatcttcgggagtttgctgataattcggagctccatgctgaatgggaatcagccaagatg
gccaacaagcagcgtttggcacagtatatactgcatgtgacaggtgtgagcatcgatcca
aattccctttttgacatacaagtcaaacgtatccatgaatacaaaaggcagcttctaaat
attctgggcgtcatctatagatacaagaagcttaagggaatgagccctgaagaaaggaaa
aatacaactcctcgcacagtcatgattggaggaaaagcatttgcaacatacacaaatgca
aaacgaattgtcaagctcgtgactgatgttggcgacgttgtcaatagtgaccctgacgtc
aatgactatttgaaggtggtttttgttcccaactacaatgtatctgtggcagagatgctt
attccgggaagtgagctatcacaacacatcagtactgcaggcatggaagcaagtggaaca
agcaacatgaaatttgcccttaatggatgccttatcattgggacactagatggggccaat
gtggaaattagggaggaaattggagaagataacttctttctttttggtgcaacagctgat
gaagttcctcaactgcgcaaagatcgagagaatggactgttcaaacctgatcctcggttt
gaagaggcaaaacaatttattaggtctggagcatttgggacgtatgattataatcccctc
cttgaatcactggaagggaactcgggatatggtcgtggagactattttcttgttggtcat
gattttccgagctacatggatgctcaggcaagggttgatgaagcttacaaggacaggaaa
agatggataaagatgtctatactgagcactagtgggagtggcaaatttagtagtgaccgt
acaatttctcaatatgcaaaagagatctggaacattgccgagtgtcgcgtgccttga
5' End
3' End
NotesCoding sequence can be found in Figure 1 of paper.
Expression VectorpNAN-GP-wtpNAN-GP-syn
Assay MethodsNorthern Blot, SDS-PAGE, ImmunoblotNorthern Blot, SDS-PAGE, Immunoblot
ResultsVery low levels of protein expressed. <0.1 micrograms GP/mg proteinMuch higher protein expression than wild-type gene. About 40 micrograms GP/mg protein/expression cassette. One strain seemed to have taken up either two or three expression cassette and expression 94.6 micrograms GP/mg protein.
Protein Functioncatalyzes phosphorolysis of α-1,4-glucan
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe authors recognized that expression of GP in filamentous fungi may be improved by lowering A+T
content in the GP coding region. Also, rare codons in the coding sequence can affect mRNA stability
and consequently reduced protein levels. The authors were not able to detect wild-type mRNA in part
due to the high levels of rare codons. Thus, the gene was modified to have A. niger codon usage
preference. The authors also reference Kazusa’s Codon Usage Database
(http://www.kazusa.or.jp/codon/)
Publication Author(s)Koda A, Bogaki T, Minetoki T, Hirotsune M
Corresponding AuthorAkio Koda
Corresponding AddressGeneral Research Laboratory, Ozeki Co., Ltd., 4-9 Imazu, Nishinomiya-shi, Hyogo 663-8227, Japan.
Publication Year2005
Publication TitleHigh expression of a synthetic gene encoding potato alpha-glucan phosphorylase in Aspergillus niger.
AbstractWe describe the successful heterologous expression of the Solanum tuberosum alpha-glucan phosphorylase (GP) gene in Aspergillus niger. Special attention was paid to the influence of different codon usage and A+T content in the coding region on GP protein expression. Use of A. niger-preferred codon usage and lower A+T content in a synthetic gene (GP-syn) resulted in a significant improvement in the level of the GP mRNA and a dramatic increase in the quantity of GP protein produced such that it accounted for approximately 10% of the total soluble protein. We suggest that redesigning the primary DNA sequence encoding a desired protein product can be an extremely effective method for improving heterologous protein production in filamentous fungi.
JournalJ Biosci Bioeng.. 100(5): 531-7.
SummaryThe authors wished to express α-glucan phosphorylase (GP) in the filamentous fungus Aspergillus niger. The fungus is a convenient system for harvesting proteins from as proteins can be secreted from cells. The authors recognized that expression of GP in filamentous fungi may be improved by lowering A+T content in the GP coding region. Also, rare codons in the coding sequence can affect mRNA stability and consequently reduced protein levels. The authors were not able to detect wild-type mRNA in part due to the high levels of rare codons. Thus, the gene was modified to have A. niger codon usage preference. The recoded gene was able to produce much more protein expression than the wild-type gene, which was almost undetectable. GP-syn produced about 40 micrograms GP/mg protein/expression cassette. One strain seemed to have taken up either two or three expression cassette of GP-syn and expressed 94.6 micrograms GP/mg protein.
Comments
Discussion
PubMed ID16384792
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site