Synthetic Gene DataBase
 

Synthetic Gene 262


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID231262
GenBank AccessionM90093AY581314
GenBank GI15540547717623
Gene NameWTA (luxA)COA (luxA)
Gene Length (bp)10831083
SpeciesPhotorhaddus luminsecensHomo sapiens
StrainsHEK293
CDSatgaaatttggaaactttttgcttacataccaacctccccaattttctcaaacagaggta
atgaaacgtttggttaaattaggtcgcatctctgaggagtgtggttttgataccgtatgg
ttactggagcatcatttcacggagtttggtttgcttggtaacccttatgtcgctgctgca
tatttacttggcgcgactaaaaaattgaatgtaggaactgccgctattgttcttcccaca
gcccatccagtacgccaacttgaagatgtgaatttattggatcaaatgtcaaaaggacga
tttcggtttggtatttgccgagggctttacaacaaggactttcgcgtattcggcacagat
atgaataacagtcgcgccttagcggaatgctggtacgggctgataaagaatggcatgaca
gagggatatatggaagctgataatgaacatatcaagttccataaggtaaaagtaaacccc
gcggcgtatagcagaggtggcgcaccggtttatgtggtggctgaatcagcttcgacgact
gagtgggctgctcaatttggcctaccgatgatattaagttggattataaatactaacgaa
aagaaagcacaacttgagctttataatgaagtggctcaagaatatgggcacgatattcat
aatatcgaccattgcttatcatatataacatctgtagatcatgactcaattaaagcgaaa
gagatttgccggaaatttctggggcattggtatgattcttatgtgaatgctacgactatt
tttgatgattcagaccaaacaagaggttatgatttcaataaagggcagtggcgtgacttt
gtattaaaaggacataaagatactaatcgccgtattgattacagttacgaaatcaatccc
gtgggaacgccgcaggaatgtattgacataattcaaaaagacattgatgctacaggaata
tcaaatatttgttgtggatttgaagctaatggaacagtagacgaaattattgcttccatg
aagctcttccagtctgatgtcatgccatttcttaaagaaaaacaacgttcgctattatat
tag
atgaagttcggcaacttcctgctcacatatcagcctccccagttttcccaaaccgaggtc
atgaagcggctggttaagctcggccgcatctccgaggagtgcggtttcgacaccgtgtgg
ctgctggagcaccacttcaccgagttcggcctgcttggtaacccttatgtcgctgctgct
tatctgctcggcgccaccaagaaactgaacgtcggcactgccgctatcgttctccccacc
gcccatccagtccgccagcttgaggacgtgaacttgctggatcaaatgtccaaggggcgc
tttcggttcggcatctgccgcgggctttacaacaaggacttccgcgtgttcggcaccgac
atgaacaacagccgcgccctggccgagtgttggtacgggctgatcaagaatggcatgacc
gagggatacatggaagccgacaatgagcacatcaagttccacaaagtcaaagtgaacccc
gccgcttacagcagaggtggcgctcctgtttatgtggtggctgagtcagctagtaccact
gagtgggctgctcaatttggcctccctatgatcctgtcctggatcatcaacactaatgag
aagaaggcccagctcgagctttacaacgaagtggctcaagagtacgggcacgacattcat
aacatcgaccactgcctgtcctacatcacctccgtggaccacgactccatcaaggccaag
gagatttgccggaagtttctcgggcattggtatgatagctacgtgaatgctaccactatc
tttgacgactccgaccagaccagaggttacgacttcaacaaggggcagtggcgcgatttc
gtgttgaaaggacacaaggatactaacagacgcatcgactacagctacgagatcaatccc
gtgggcacccctcaggagtgcattgacatcatccaaaaggacattgatgctaccggaatc
tccaacatctgttgtggatttgaggctaacggaaccgtggacgagatcatcgcttccatg
aagctcttccagtccgatgtcatgccattcctcaaggagaagcaacgcagcctcctgtac
tag
5' End
3' End
Notes
Expression VectorpWTA-I-WTBpCOA-I-COA
Assay Methodsbioluminescence, northern blot, western blotbioluminescence, northern blot, western blot
ResultsBioluminescence levels were 5x10^5 RLU/mg total protein (WTA/WTB).Bioluminescence levels were 2.9x10^6 RLU/mg total protein when transfected with COA/WTB. When transfected with both optimized genes, COA/COB, bioluminescence was further increased to 2.7x10^7 RLU/mg total protein.
Protein Functionluciferase
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usage of wild-type lux genes were compared to that of mammalian genes tabulated in Genbank.
Codons were randomly replaced to more closely match mammalian codon usage. NetGene2
(http://www.cbs.dtu.dk/index.html) was used to determine and remove potential splice sites and the
final sequences were compared to the wild-type sequence using Genescan (http://genes.mit.edu).
Publication Author(s)Patterson, S. S.; Dionisi, H. M.; Gupta, R. K.; Sayler, G. S.
Corresponding AuthorGary S. Sayler
Corresponding AddressDepartment of Microbiology, The University of Tennessee, Knoxville, TN 37996, USA.
Publication Year2005
Publication TitleCodon optimization of bacterial luciferase (lux) for expression in mammalian cells
AbstractExpression of the bacterial luciferase (lux) system in mammalian cells would culminate in a new generation of bioreporters for in vivo monitoring and diagnostics technology. Past efforts to express bacterial luciferase in mammalian cells have resulted in only modest gains due in part to low overall expression of the bacterial genes. To optimize expression, we have designed and synthesized codon-optimized versions of the luxA and luxB genes from Photorhabdus luminsecens. To evaluate these genes in vivo, stable HEK293 cell lines were created harboring wild type luxA and luxB (WTA/WTB), codon-optimized luxA and wild type luxB (COA/WTB), and codon-optimized versions of both luxA and luxB genes (COA/COB). Although mRNA levels within these clones remained approximately equal, LuxA protein levels increased significantly after codon optimization. On average, bioluminescence levels were increased by more than six-fold [5x10(5) vs 2.9x10(6) relative light units (RLU)/mg total protein] with the codon-optimized luxA and wild type luxB. Bioluminescence was further enhanced upon expression of both optimized genes (2.7x10(7) RLU/mg total protein). These results show promise toward the potential development of an autonomous light generating lux reporter system in mammalian cells.
JournalJ Ind Microbiol Biotechnol. 32(3): 115-23.
SummaryThe authors wished to synthesize a luciferase reporter gene sensitive enough to be used for in vivo monitoring and diagnostics technology. The authors tackled the problem by synthesizing codon optimized versions of luxA and luxB genes from Photorhaddus luminsecens. Codon usage of wild-type lux genes were compared to that of mammalian genes tabulated in Genbank. Codons were randomly replaced to more closely match mammalian codon usage. NetGene2 (http://www.cbs.dtu.dk/index.html) was used to determine and remove potential splice sites and the final sequences were compared to the wild-type sequence using Genescan (http://genes.mit.edu). mRNA levels of both the wild-type and recoded genes were found to be similar. Recoding luxA only produced a six-fold increase in bioluminescence levels but recoding both luxA and luxB produced nearly 60-fold increase in bioluminescence.
Comments
Discussion
PubMed ID15761767
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site