Synthetic Gene DataBase
 

Synthetic Gene 264


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID234264
GenBank AccessionAF372525AX146235
GenBank GI1416147414284753
Gene NameRenilla mulleri GFPRMG
Gene Length (bp)702717
SpeciesRenilla mulleriHomo sapiens
StrainsJurkat-E acute lymphoblastic leukemia cells
CDSatggatctcgcaaaacttggtttgaaggaagtgatgcctactaaaatcaacttagaagga
ctggttggcgaccacgctttctcaatggaaggagttggcgaaggcaacatattggaagga
actcaagaggtgaagatatcggtaacaaaaggcgcaccactcccattcgcatttgatatc
gtatctgtggctttttcatatgggaacagagcttataccggttacccagaagaaatttcc
gactacttcctccagtcgtttccagaaggctttacttacgagagaaacattcgttatcaa
gatggaggaactgcaattgttaaatctgatataagcttggaagatggtaaattcatagtg
aatgtagacttcaaagcgaaggatctacgtcgcatgggaccagtcatgcagcaagacatc
gtgggtatgcagccatcgtatgagtcaatgtacaccaatgtcacttcagttataggggaa
tgtataatagcattcaaacttcaaactggcaagcatttcacttaccacatgaggacagtt
tacaaatcaaagaagccagtggaaactatgccattgtatcatttcatccagcatcgcctc
gttaagaccaatgtggacacagccagtggttacgttgtgcaacacgagacagcaattgca
gcgcattctacaatcaaaaaaattgaaggctctttaccatag
atgagtaaacaaatattgaagaacacttgtttacaagaagtaatgtcgtataaagtaaat
ctggaaggaattgtaaacaaccatgtttttacaatggagggttgcggcaaagggaatatt
ttattcggcaatcaactggttcagattcgtgtcacgaaaggggccccactgccttttgca
tttgatattgtgtcaccagcttttcaatatggcaaccgtactttcacgaaatatccgaat
gatatatcagattattttatacaatcatttccagcaggatttatgtatgaacgaacatta
cgttacgaagatggcggacttgttgaaattcgttcagatataaatttaatagaagacaag
ttcgtctacagagtcgaatacaaaggtagtaacttcccagatgatggtcccgtcatgcag
aagactatcttaggaatagagccttcatttgaagccatgtacatgaataatggcgtcttg
gtcggcgaagtaattcttgtctataaactaaactctgggaaatattattcatgtcacatg
aaaacattaatgaagtcgaaaggtgtagtaaaggagtttccttcgtatcattttattcaa
catcgtttggaaaagacttacgtagaagacggggggttcgttgaacagcatgagactgct
attgctcaaatgacatctataggaaaaccactaggatccttacacgaatgggtttaa
5' End
3' End
NotesThis may or may not be a wild-type sequence.Sequence taken from another paper by same author: Anderson.
Expression Vectorp96.7rmg
Assay MethodsFACS, Western blot
ResultsNot tested.1.4x brighter than enhanced GFP due to 1.4x more protein product expressed.
Protein Functionreporter gene
Recoding PurposeTo improve expression
Synthesized ByBiosource
Recoding MethodGene was completely optimized for human codon usage except for 9 unoptimized codons used to create
restriction sites.
Publication Author(s)Peelle, B.; Gururaja, T. L.; Payan, D. G.; Anderson, D. C.
Corresponding AuthorTarikere L. Gururaja
Corresponding AddressProtein Chemistry Department, Rigel Pharmaceuticals, Inc., S. San Francisco, California 94080, USA.
Publication Year2001
Publication TitleCharacterization and use of green fluorescent proteins from Renilla mulleri and Ptilosarcus guernyi for the human cell display of functional peptides
AbstractGreen fluorescent protein (GFP) is useful as an intracellular scaffold for the display of random peptide libraries in yeast. GFPs with a different sequence from Aequorea victoria have recently been identified from Renilla mulleri and Ptilosarcus gurneyi. To examine these proteins as intracellular scaffolds for peptide display in human cells, we have determined the expression level of retrovirally delivered human codon-optimized versions in Jurkat-E acute lymphoblastic leukemia cells using fluorescence activated cell sorting and Western blots. Each wild type protein is expressed at 40% higher levels than A. victoria mutants optimized for maximum fluorescence. We have compared the secondary structure and stability of these GFPs with A. victoria GFP using circular dichroism (CD). All three GFPs essentially showed a perfect beta-strand conformation and their melting temperatures (Tm) are very similar, giving an experimental evidence of a similar overall structure. Folded Renilla GFP allows display of an influenza hemagglutinin epitope tag in several internal insertion sites, including one which is not permissive for such display in Aequorea GFP, giving greater flexibility in peptide display options. To test display of a functional peptide, we show that the SV-40 derived nuclear localization sequence PPKKKRKV, when inserted into two different potential loops, results in the complete localization of Renilla GFP to the nucleus of human A549 cells.
JournalJ Protein Chem. 20(6): 507-19.
SummaryThe authors wished to compare the relative sensitivity of GFP reporters in mammalian cells. EGFP, an optimized gene was match against two humanized GFP genes. These were RMG from Renilla mulleri PGG from Ptilosarcus gurneyi. The wild-type genes were recoded so that all codons represented highly used human codons. Only about 10 codons in each recoded gene were not fully optimized because they doubled as restriction sites. FACS indicated that EGFP not quite as bright as these recoded GFPs, which were able to express more protein product and thus produce brighter fluorescence. Overall, these genes have been successfully optimized, given they are almost 40% brighter than EGFP, which is considered a relatively sensitive reporter gene.
Comments
Discussion
PubMed ID11760126
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site