Synthetic Gene DataBase
 

Synthetic Gene 266


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID236266
GenBank AccessionNM_203353
GenBank GI42741676
Gene NameLMP-3 (LIM mineralization protein-3)hLMP-3
Gene Length (bp)462462
SpeciesHomo sapiensMus musculus
StrainsMC3T3-E1, NIH3T3
CDSatggattccttcaaagtagtgctggaggggccagcaccttggggcttccggctgcaaggg
ggcaaggacttcaatgtgcccctctccatttcccggctcactcctgggggcaaagcggcg
caggccggagtggccgtgggtgactgggtgctgagcatcgatggcgagaatgcgggtagc
ctcacacacatcgaagctcagaacaagatccgggcctgcggggagcgcctcagcctgggc
ctcagcagggcccagccggttcagagcaaaccgcagaaggcctccgcccccgccgcggac
cctccgcggtacacctttgcacccagcgtctccctcaacaagacggcccggccctttggg
gcgcccccgcccgctgacagcgccccgcagcagaatgggtgcagacccctgacaaacagc
cgctccgaccgctggtcccagatgccagcaagcagcggctga
atggatagtttcaaagtggtcctggaagggcccgcgccctggggcttccggctgcagggg
ggaaaggatttcaatgttcccctgtcaatcagtcggctcaccccgggcggcaaggcggct
caagccggcgtcgcagtgggcgactgggtcctcagcatcgatggtgagaatgcggggtcc
ctgacccatattgaggcccagaacaagatccgggcttgcggtgagcgtctgtccctcggt
cttagtcgagcccagcctgtccagtccaaacctcagaaggcctccgctccagctgccgac
ccccctagatacacctttgccccaagtgtgtccctcaataagaccgcgaggcccttcggg
gcacccccccctgcggactcggccccgcagcagaatgggtgtcggcccctgaccaacagc
agatcggaccgctggtcccagatgcccgcctcaagtggctga
5' End
3' End
NotesCoding sequence edited manually from wild-type sequence. Expect human error.
Expression VectorpAd.loxpcDNA3.1/hLMP3
Assay Methods
Resultscoding sequence does not match sequence presented in paper 100%, but is very close.hLMP-3 induces expression of bone specific genes, bone mineralization and direct gene transfer into mouse skeletal muscle causes ectopic bone formation more efficiently than BMP-2.
Protein Functioninvolved in bone development
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe optimized LMP-3 was constructed using an algorithm that designs a series of overlapping primers
that are then used for PCR amplification. A screenshot of the program used is including in the
paper. The mentioned algorithm was in reference to a previous paper by one of the authors (Gao W et
al. A web-based DNA codon optimization algorithm.)
Publication Author(s)Pola, E.; Gao, W.; Zhou, Y.; Pola, R.; Lattanzi, W.; Sfeir, C.; Gambotto, A.; Robbins, P. D.
Corresponding AuthorPD Robbins
Corresponding AddressDepartment of Molecular Genetics and Biochemistry, University of Pittsburgh, PA, USA.
Publication Year2004
Publication TitleEfficient bone formation by gene transfer of human LIM mineralization protein-3
AbstractLIM mineralization protein (LMP) is a novel positive regulator of the osteoblast differentiation program. In humans, three different LMP splice variants have been identified: LMP-1, LMP-2, and LMP-3. Gene transfer of human LMP-1 (hLMP-1) induces expression of genes involved in bone formation, including certain bone morphogenetic proteins (BMPs), promotes bone nodule formation in vitro, ectopic bone formation in vivo, and is therapeutic in animal models of posterior thoracic and lumbar spine fusion. To examine the osteoinductive properties of the LMP-3 in vitro and in vivo, we have generated plasmid and adenoviral vectors expressing codon-optimized hLMP-3. Here we demonstrate that gene transfer of hLMP-3 induces expression of the bone-specific genes osteocalcin, osteopontin, and bone sialoprotein and induced bone mineralization in preosteoblastic and fibroblastic cells. We also demonstrate that hLMP-3 is able to induce bone mineralization and the expression of the bone-specific genes, BMP-2, OSX, RunX2, and alkaline phosphatase in human mesenchymal stem cells in a dose-dependent manner. Finally, we demonstrate that direct gene transfer of hLMP-3 into murine skeletal muscle results in ectopic bone formation more efficiently than BMP-2. These results demonstrate that hLMP-3 gene transfer can be used to promote bone formation in cell culture and in vivo as or more efficiently than BMP-2, thus establishing feasibility and efficacy of direct gene delivery of hLMP-3 to produce bone in vivo. These results suggest that gene transfer of hLMP-3 could be developed as a bone-inductive therapeutic agent for clinical applications.
JournalGene Ther. 11(8): 683-93.
SummaryThis paper is primarily a study of LMP-3 protein characteristics and NOT codon optimization.
Comments
Discussion The authors wished to study the osteoinductive properties of the LIM mineralization protein-3 (LMP-3
PubMed ID14724674
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site