Synthetic Gene DataBase
 

Synthetic Gene 267


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID237267
GenBank AccessionX03453AY056050
GenBank GI1513517016299
Gene NameCreiCre
Gene Length (bp)10321067
SpeciesEnterobacteria phage P1Homo sapiens; Mus musculus
StrainsHEK293; intramuscular injection
CDSatgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagt
gatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcat
acctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataac
cggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcg
cgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgt
cggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatc
cgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcact
gatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaat
ctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatc
agggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacg
aaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactg
gtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgc
cgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgcc
ctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggt
cagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcc
cgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatatt
gtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaa
gatggcgattagccattaacgcg
atggtgcccaagaagaagaggaaagtctccaacctgctgactgtgcaccaaaacctgcct
gccctccctgtggatgccacctctgatgaagtcaggaagaacctgatggacatgttcagg
gacaggcaggccttctctgaacacacctggaagatgctcctgtctgtgtgcagatcctgg
gctgcctggtgcaagctgaacaacaggaaatggttccctgctgaacctgaggatgtgagg
gactacctcctgtacctgcaagccagaggcctggctgtgaagaccatccaacagcacctg
ggccagctcaacatgctgcacaggagatctggcctgcctcgcccttctgactccaatgct
gtgtccctggtgatgaggagaatcagaaaggagaatgtggatgctggggagagagccaag
caggccctggcctttgaacgcactgactttgaccaagtcagatccctgatggagaactct
gacagatgccaggacatcaggaacctggccttcctgggcattgcctacaacaccctgctg
cgcattgccgaaattgccagaatcagagtgaaggacatctcccgcaccgatggtgggaga
atgctgatccacattggcaggaccaagaccctggtgtccacagctggtgtggagaaggcc
ctgtccctgggggttaccaagctggtggagagatggatctctgtgtctggtgtggctgat
gaccccaacaactacctgttctgccgggtcagaaagaatggtgtggctgccccttctgcc
acctcccaactgtccacccgggccctggaagggatctttgaggccacccaccgcctgatc
tatggtgccaaggatgactctgggcagagatacctggcctggtctggccactctgccaga
gtgggtgctgccagggacatggccagggctggtgtgtccatccctgaaatcatgcaggct
ggtggctggaccaatgtgaacatagtgatgaactacatcagaaacctggactctgagact
ggggccatggtgaggctgctcgaggatggggactgaaactgagtcga
5' Endgaggaagcttgtccaccatggtgcgaggaagcttgtccaccatggtgc
3' Endgactgaaactgagtcgacggagcggactgaaactgagtcgacggagcg
Notes
Expression VectorpBKC-Cre-ABDpBKC-iCre-ABD
Assay MethodsBeta-gal assayBeta-gal assay
ResultsCre protein expression was about 2/3 that of recoded gene.Expression of functional iCre protein to be 1.5x improved, which resulted in about 1.7x higher DNA recombination over that of Cre.
Protein FunctionCre recombinase
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe authors applied mammalian codon usage to the Cre recombinase gene, reducing high CpG content
characteristic of prokaryotes and removing cryptic splice sites. The splice site prediction
programs at www.cbs.dtu.dk/services/NetGene2/ and www.fruitfly.org/seq_tools/splice.html were used.
Publication Author(s)Shimshek, D. R.; Kim, J.; Hubner, M. R.; Spergel, D. J.; Buchholz, F.; Casanova, E.; Stewart, A. F.; Seeburg, P. H.; Sprengel, R.
Corresponding AuthorR. Sprengel
Corresponding AddressDepartment of Molecular Neuroscience, Max-Planck Institute for Medical Research, Heidelberg, Germany.
Publication Year2002
Publication TitleCodon-improved Cre recombinase (iCre) expression in the mouse
AbstractBy applying the mammalian codon usage to Cre recombinase, we improved Cre expression, as determined by immunoblot and functional analysis, in three different mammalian cell lines. The improved Cre (iCre) gene was also designed to reduce the high CpG content of the prokaryotic coding sequence, thereby reducing the chances of epigenetic silencing in mammals. Transgenic iCre expressing mice were obtained with good frequency, and in these mice loxP-mediated DNA recombination was observed in all cells expressing iCre. Moreover, iCre fused to two estrogen receptor hormone binding domains for temporal control of Cre activity could also be expressed in transgenic mice. However, Cre induction after administration of tamoxifen yielded only low Cre activity. Thus, whereas efficient activation of Cre fusion proteins in the brain needs further improvements, our studies indicate that iCre should facilitate genetic experiments in the mouse.
JournalGenesis. 32(1): 19-26.
SummaryThe authors wanted to improve the enzymatic activity of Cre recombinase in mammalian cells both in vitro and in vivo. The authors applied mammalian codon usage to the Cre recombinase gene, reducing high CpG content characteristic of prokaryotes and removing cryptic splice sites. Human HEK293 cells were transfected with Cre and iCre (improved Cre) with lacZ and Beta-gal activity was measured. The authors found that recoding improved the expressing of functional iCre protein to be 1.5x improved, which resulted in about 1.7x higher DNA recombination over that of Cre. Protein levels were determined by X-gal staining.
Comments
Discussion
PubMed ID11835670
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site