Synthetic Gene DataBase
 

Synthetic Gene 268


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID238268
GenBank AccessionU14524AY195802
GenBank GI55955828883186
Gene NamewtGluClα1optGluClα1
Gene Length (bp)13861386
SpeciesCaenorhabditis elegansMus musculus
StrainsN2
CDSatggctacctggattgtcggaaagctgatcattgcatctttaattttgggaatacaagcc
caacaagctagaacgaaatcacaagatattttcgaagatgataatgataatggaacgact
acactggaatcgctagccagattaacatccccgattcacattccaattgaacaacctcaa
acatcggactcaaaaattctagctcatcttttcacatctggatacgatttccgagtgcga
cctccaacagataatggaggaccagttgtggtttcagttaacatgctccttcgaactatt
tcaaagatagatgttgtgaatatggagtatagtgctcaattgacattgcgagagagttgg
attgacaagagactcagctacggagtaaaaggagatggtcagccagattttgtgattctc
actgttggacatcaaatttggatgcccgacacgtttttcccgaatgagaaacaagcttac
aagcatacgattgataagccgaatgtattgattcgaatacacaatgatggtacagtattg
tactctgttcgtatttcactagtcctctcttgcccaatgtatctacagtactatccaatg
gatgttcaacagtgttccattgatcttgcatcgtatgcctacactacaaaagatatcgaa
tatttgtggaaagagcattcaccacttcagttaaaggttggattatcaagctcgttgcct
tcattccagttgactaatacttcaacgacatattgcaccagtgtaacaaacactggcatt
tattcctgtttgcgaactactattcagttaaagagagagttcagtttttaccttctccaa
ctctacatcccgtcatgcatgctagtcatcgtatcctgggtttcattttggtttgatcga
actgcaatcccggctcgtgtcaccctcggagtcaccacgctgcttacaatgacagctcaa
tcagccggtatcaattcacaactacctccagtttcctatatcaaggcgattgatgtctgg
attggtgcatgtatgacattcattttctgcgcgttgttggagtttgcattggtaaatcat
atagctaacaagcagggtgttgagagaaaagctcgaactgaaagagagaaagctgaaatt
ccacttcttcaaaatttgcacaatgatgttcccacaaaggttttcaatcaagaggaaaaa
gtaaggacagttccactgaatcgccggcaaatgaatagcttcttgaatttgctcgagaca
aaaaccgaatggaatgacatatcaaaacgagtcgatcttatttctcgagccctgtttcct
gttctattttttgtttttaacattttgtactggtctcgttttggccagcagaacgtatta
ttttag
atggccacgtggatcgtgggcaagctgatcatcgcttccctgatcctggggatccaggcc
cagcaggcccgcaccaagagccaggacatcttcgaggacgacaacgacaacggcactacc
accctggagtccctggctcgcctgacctcccccatccacatccccatcgagcagccccag
acctccgacagcaagatcctggcccacctgttcaccagcggctacgacttccgcgtgcgc
ccccccaccgacaacggcggccccgtggtggtgagcgtgaacatgctgctgcgcaccatc
agcaagatcgacgtggtgaacatggagtactccgcccagctgaccctgcgcgagagctgg
atcgacaagcgcctgtcctacggcgtcaagggcgacggccagcccgacttcgtcatcctg
accgtgggccaccagatctggatgcccgacaccttcttccccaacgagaagcaggcttac
aagcacaccatcgacaagcccaacgtcctgatccgcatccacaacgacggcaccgtcctg
tactccgtccgcatcagcctggtgctgagctgccccatgtacctgcagtactacccgatg
gacgtgcagcagtgcagcatcgacctggcctcctacgcctacaccaccaaggacatcgag
tatctgtggaaggagcacagccccctgcagctgaaggtcggcctgtcctccagcctgccc
agcttccagctgaccaacaccagcaccacctactgcaccagcgtcaccaacaccggcatc
tacagctgcctgaggaccaccatccagctgaagcgcgagttctccttctacctgctgcaa
ctgtacatccccagctgcatgctcgtgatcgtgtcctgggtgtccttctggttcgaccgc
accgccatccccgcccgcgtcaccctgggcgtgaccaccctgctgaccatgaccgctcag
tccgctggcatcaacagccagctgccccccgtgagctacatcaaggccatcgacgtgtgg
atcggcgcctgcatgaccttcatcttctgcgccctgctggagttcgccctggttaaccac
atcgcgaacaagcagggcgtggagcgcaaggcccgcaccgagcgcgagaaggccgagatc
cccctgctgcagaacctgcacaacgacgtccccaccaaggtgttcaaccaggaggagaaa
gtccgcaccgtgcccctgaaccgccggcagatgaattccttcctgaacctgctggagacc
aagaccgagtggaacgacatcagcaagcgcgtggacctgatcagccgcgccctgttcccc
gtgctgttcttcgtgttcaacatcctgtactggagccgcttcggccagcagaacgttctg
ttctga
5' End
3' End
Notes
Expression VectorpcDNA3.1/TOPO-HISTpcDNA3.1/TOPO-HIST
Assay Methodsmembrane voltage measurement, fluorescent imagingmembrane voltage measurement, fluorescent imaging
ResultsFluorescence is hardly visible, indicating protein expression is low.Codon optimization resulted in a 6 to 9 fold increase in expression as seen from EYFP fluorescence.
Protein Functionchloride channel
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe authors compile 52 highly expressed mouse gene and then used this information to find the CAI
values of GluClα1 (0.55) and GluClβ (0.58). The GluClα1 gene was recoded and attached to already
optimized fluorescent protein reporters EYGP. The authors hypothesized recoding the GluCl genes in
a similar fashion as Haas et al. recoded the GFP gene would improved GluCl protein expression.
Recoding brought the CAI value above 0.95.
Publication Author(s)Slimko, E. M.; Lester, H. A.
Corresponding AuthorHenry A. Lester
Corresponding AddressM/C 156-29, Computation and Neural Systems, California Institute of Technology, 1200 East California Boulevard, Pasadena 91125, USA.
Publication Year2003
Publication TitleCodon optimization of Caenorhabditis elegans GluCl ion channel genes for mammalian cells dramatically improves expression levels
AbstractOrganisms use synonymous codons in a highly non-random fashion. These codon usage biases sometimes frustrate attempts to express high levels of exogenous genes in hosts of widely divergent species. The Caenorhabditis elegans GluClalpha1 and GluClbeta genes form a functional glutamate and ivermectin-gated chloride channel when expressed in Xenopus oocytes, but expression is weak in mammalian cells. We have constructed synthetic genes that retain the amino acid sequence of the wild-type GluCl channel proteins, but use codons that are optimal for mammalian cell expression. We have tagged the native and codon-optimized GluCl cDNAs with enhanced yellow fluorescent protein (EYFP, GluClalpha1 subunit) and enhanced cyan fluorescent protein (EFCP, GluClbeta subunit), expressed the channels in E18 rat hippocampal neurons and measured the relative expression levels of the two genes with fluorescence microscopy as well as with electrophysiology. Codon optimization provides a 6- to 9-fold increase in expression, allowing the conclusions that the ivermectin-gated channel has an EC(50) of 1.2 nM and a Hill coefficient of 1.9. We also confirm that the Y182F mutation in the codon-optimized beta subunit results in a heteromeric channel that retains the response to ivermectin while reducing the response to 100 microM glutamate by 7-fold. The engineered GluCl channel is the first codon-optimized membrane protein expressed in mammalian cells and may be useful for selectively silencing specific neuronal populations in vivo.
JournalJ Neurosci Methods. 124(1): 75-81.
SummaryThe authors found that Caenorhabditis elegans GluClα1 and GluClβ genes are sufficient for forming a chloride channel when expressed in Xenopus oocytes. On the other hand, expression is weak in mammals, probably reason of non-representative codon usage. The authors compile 52 highly expressed mouse gene and then used this information to find the CAI values of GluClα1 (0.55) and GluClβ (0.58). The genes were recoded and attached to already optimized fluorescent protein reporters EYGP and EFCP. The authors hypothesized recoding the GluCl genes in a similar fashion as Haas et al. recoded the GFP gene would improved GluCl protein expression. Recoding brought CAI values above 0.95 for both genes. Codon optimization resulted in a 6 to 9 fold increase in expression as seen from EYFP and ECFP fluorescence.
Comments
Discussion
PubMed ID12648766
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site