Synthetic Gene DataBase
 

Synthetic Gene 270


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID240270
GenBank AccessionAY015993
GenBank GI12621053
Gene NameGLuc (Gaussia luciferase)hGLuc
Gene Length (bp)558558
SpeciesGaussia princepsHomo sapiens
Strains293T
CDSatgggagtgaaagttctttttgcccttatttgtattgctgtggccgaggccaaaccaact
gaaaacaatgaagatttcaacattgtagctgtagctagcaactttgctacaacggatctc
gatgctgaccgtggtaaattgcccggaaaaaaattaccacttgaggtactcaaagaaatg
gaagccaatgctaggaaagctggctgcactaggggatgtctgatatgcctgtcacacatc
aagtgtacacccaaaatgaagaagtttatcccaggaagatgccacacctatgaaggagac
aaagaaagtgcacagggaggaataggagaggctattgttgacattcctgaaattcctggg
tttaaggatttggaacccatggaacaattcattgcacaagttgacctatgtgtagactgc
acaactggatgcctcaaaggtcttgccaatgtgcaatgttctgatttactcaagaaatgg
ctgccacaaagatgtgcaacttttgctagcaaaattcaaggccaagtggacaaaataaag
ggtgccggtggtgattaa
atgggagtcaaagttctgtttgccctgatctgcatcgctgtggccgaggccaagcccacc
gagaacaacgaagacttcaacatcgtggccgtggccagcaacttcgcgaccacggatctc
gatgctgaccgcgggaagttgcccggcaagaagctgccgctggaggtgctcaaagagatg
gaagccaatgcccggaaagctggctgcaccaggggctgtctgatctgcctgtcccacatc
aagtgcacgcccaagatgaagaagttcatcccaggacgctgccacacctacgaaggcgac
aaagagtccgcacagggcggcataggcgaggcgatcgtcgacattcctgagattcctggg
ttcaaggacttggagcccatggagcagttcatcgcacaggtcgatctgtgtgtggactgc
acaactggctgcctcaaagggcttgccaacgtgcagtgttctgacctgctcaagaagtgg
ctgccgcaacgctgtgcgacctttgccagcaagatccagggccaggtggacaagatcaag
ggggccggtggtgactaa
5' Endctcgcggaattcaaaatgaaaccaactgaactcgcggaattcaaaatgggagtcaaacttctg
3' Endggtgccggtggtgattaatgcctcgaggcagctgccggtggtgactagtaatgcctcgaggcagct
Notes
Expression VectorpHGC-GLucpHGC-hGLuc
Assay Methodsbioluminescencebioluminescence
ResultsLuminescence is almost undetectable at 1-10 photons per second, compared to humanized GLuc at 1000-1000- photons per second.The bioluminescent signal of the recoded gene is 2000 times higher than that of wild-type GLuc. Intensity was 200-fold higher than humanized Renilla luciferase. Luminescence was comparable to that of firefly luciferase in vivo.
Protein Functionreporter gene
Recoding PurposeTo improve expression
Synthesized ByNanolight
Recoding MethodCoding sequence recoded for mammalian cells by Nanolight.
Publication Author(s)Tannous, B. A.; Kim, D. E.; Fernandez, J. L.; Weissleder, R.; Breakefield, X. O.
Corresponding AuthorBakhos A. Tannous
Corresponding AddressCenter for Molecular Imaging Research, Department of Radiology, Massachusetts General Hospital, Charlestown, MA 02129, USA. btannous@hms.harvard.edu
Publication Year2005
Publication TitleCodon-optimized Gaussia luciferase cDNA for mammalian gene expression in culture and in vivo
AbstractPhotoproteins have played a major role in advancing our understanding of biological processes. A broader array of biocompatible, nontoxic, and novel reporters can serve to expand this potential. Here we describe the properties of a luciferase from the copepod marine organism Gaussia princeps. It is a monomeric protein composed of 185 aa (19.9 kDa) with a short coding sequence (555 bp) making it suitable for viral vectors. The humanized form of Gaussia luciferase (hGLuc) was efficiently expressed in mammalian cells following delivery by HSV-1 amplicon vectors. It was found to be nontoxic and naturally secreted, with flash bioluminescence characteristics similar to those of other coelenterazine luciferases. hGLuc generated over 1000-fold higher bioluminescent signal intensity from live cells together with their immediate environment and over 100-fold higher intensity from viable cells alone (not including secreted luciferase) or cell lysates, compared to humanized forms of firefly (hFLuc) and Renilla (hRLuc) luciferases expressed under similar conditions. Furthermore, hGLuc showed 200-fold higher signal intensity than hRLuc and intensity comparable to that of hFLuc in vivo under standard imaging conditions. Gaussia luciferase provides a sensitive means of imaging gene delivery and other events in living cells in culture and in vivo, with a unique combination of features including high signal intensity, secretion, and ATP independence, thus being able to report from the cells and their environment in real time.
JournalMol Ther. 11(3): 435-43.
SummaryThe authors show the advantages of using Gaussia luciferase (GLuc) over other luciferases as a reporter gene. The experiment focuses both on in vitro bioluminescence, which does not account for secreted luciferase and in vivo bioluminescence, which does account for secreted luciferase. The authors found that wild-type GLuc expression was very low compared to humanized Gaussia luciferase (hGLuc) from bioluminescence assay. hGLuc intensity was then compared to humanized firefly and Renilla luciferase and then found to be many hundred times more intense in vitro and as intense in vivo. Also, hGLuc has the advantage of small protein size compared to the other luciferases. Recoding of GLuc was done by Nanolight and details were not included in this paper.
CommentsThis paper reports on the results of previously recoded genes.
Discussion
PubMed ID15727940
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site