Synthetic Gene DataBase
 

Synthetic Gene 273


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID243273
GenBank AccessionDQ349228
GenBank GI84795124
Gene NamertTAopt-rtTA
Gene Length (bp)7471008
SpeciesNot specifiedMus musculus
StrainsFVB/N
CDSatgtctagactggacaagagcaaagtcataaacggcgctctggaattactcaatggagtc
ggtatcgaaggcctgacgacaaggaaactcgctcaaaagctgggagttgagcagcctacc
ctgtactggcacgtgaagaacaagcgggccctgctcgatgccctgccaatcgagatgctg
gacaggcatcatacccacttctgccccctggaaggcgagtcatggcaagactttctgcgg
aacaacgccaagtcattccgctgtgctctcctctcacatcgcgacggggctaaagtgcat
ctcggcacccgcccaacagagaaacagtacgaaaccctggaaaatcagctcgcgttcctg
tgtcagcaaggcttctccctggagaacgcactgtacgctctgtccgccgtgggccacttt
acactgggctgcgtattggaggaacaggagcatcaagtagcaaaagaggaaagagagaca
cctaccaccgattctatgcccccacttctgagacaagcaattgagctgttcgaccggcag
ggagccgaacctgccttccttttcggcctggaactaatcatatgtggcctggagaaacag
ctaaagtgcgaaagcggcgggccggccgacgcccttgacgattttgacttagacatgctc
ccagccgatgcccttgacgactttgaccttgatatgctgcctgctgacgctcttgacgat
tttgaccttgacatgctccccgggtaa
atgtctagactggataaaagtaaggtgattaacagcgcactggagctgcttaatgaggtc
ggaatcgaaggtctgacaacccggaaactcgcccagaagctcggtgtagagcagcctaca
ctgtattggcatgtgaaaaataagcgggctttgctcgacgccctggccattgagatgctg
gataggcaccatactcacttttgccctctgaaaggggaaagctggcaagattttctgcgc
aataacgctaaaagttttagatgtgctctgctgagtcatcgcaatggagcaaaagtgcat
tcagatacacggcctacagaaaaacagtatgaaactctcgaaaatcaactggcctttctg
tgccagcaaggtttttcactggagaacgccctgtatgcactcagcgctgtggggcatttc
actctgggttgcgtgttggaagatcaagagcatcaagtcgctaaagaagaaagggaaaca
cctactactgatagtatgcctccactgctgcggcaagctatcgaactgtttgatcaccaa
ggtgcagagccagccttcctgttcggccttgaattgatcatctgcggactggaaaaacaa
cttaaatgtgaaagtgggtccgcctacagccgcgcccggaccaaaaacaattacgggtct
accatcgagggcctgctcgatctcccacacgacgacgcccccgaagaggccgggctggcc
gctccacgcctgtcctttctccccgccggacacacccgcagactgtccaccgccccccct
accgatgtcagcctgggggacgagctccacctggacggcgaggacgtggccatggcccat
gccgacgccctggacgatttcgatctggacatgttgggggagggggattcccccggtccc
ggatttaccccccacgactccgccccctacggcgctctggatatggccgacttcgagttt
gagcagatgtttaccgatgcccttggaattgacgagtacggtgggtag
5' Endacaagtccttgcagtggttcggtgggagatcgagcaggccctcg
3' Endgatactctgtggctgttggtggatcttccaacacgcaacccag
NotesCoding sequence obtained using OCR.
Expression VectorpTet-OnpBIL
Assay MethodsImmunoblotting, Northern blotImmunoblotting, Northern blot
Resultsluciferase activity 20-fold average induction (doxycycline), mRNA levels similar to opt-rtTAluciferase activity 832-fold average induction (doxycycline), mRNA levels similar to wild-type rtTA
Protein Functiontranscription factor
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe severe prokaryotic bias of the rtTA gene was addressed by recoding the 52 codons to reflect
mouse codon usage. A total of 70 bps were changed. The codon usage database for Mus musculus in
Genbank was referenced.
Publication Author(s)Valencik, M. L.; McDonald, J. A.
Corresponding AuthorJohn A. McDonald
Corresponding AddressDepartment of Biochemistry and Molecular Biology, Mayo Clinic Scottsdale, AZ 85259, USA.
Publication Year2001
Publication TitleCodon optimization markedly improves doxycycline regulated gene expression in the mouse heart
AbstractTetracycline regulated gene expression in transgenic animals is potentially a very powerful technique (Furth et al., 1994; Gossen & Bujard 1992). We have utilized this system in an attempt to overcome the perinatal lethality resulting from constitutive transgenic expression in the heart (Valencik & McDonald, Am J Physiol Heart Circ Physiol 280: H361-H367). We found that compound hemizygous animals created by mating selected reverse tetracycline transactivator (rtTA) and transresponder (TR) lines display tightly regulated TR expression in the heart. However, we identified two fundamental problems. First, codon usage bias appeared to severely limit the expression of the rtTA driven by the cardiac alpha-myosin heavy chain promoter. Second, co-injection of rtTA and TR transgenes led to compound hemizygous animals that exhibited unregulated TR gene expression. Codon optimization of the rtTA construct leads to marked improvement (increasing the average induction from 20-fold to 832-fold) in cardiac myocyte expression. The resulting opt-rtTA lines can be bred to homozygosity, facilitating rapid screening of F0 TR animals for doxycycline regulated transgene expression.
JournalTransgenic Res. 10(3): 269-75.
SummaryA major problem with transgenic expression in the heart is constitutive expression leads to perinatal lethality. In this paper, the authors attempt to address the problem by implemented a reverse tetracycline transactivator (rtTA) and transresponder (TR) to tightly regulate TR expression in the heart. However, the authors were immediately faced with two problems, one of which is disparity in codon usage limiting the expression of the rtTA. The severe prokaryotic bias of the rtTA gene was addressed by recoding the 52 codons to reflect mouse codon usage. The second problem was that only hemizygous animals could be produced initially, which would have to be bred to homozygosity. Codon optimization raised the average doxycycline induction from 20-fold to 832-fold, a very dramatic increased compared to past experiments. mRNA levels were similar, so we can conclude that improvement resulted from more compatible codon usage.
Comments
Discussion
PubMed ID11437283
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site