Synthetic Gene DataBase
 

Synthetic Gene 274


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID244274
GenBank Accession
GenBank GI
Gene NameS2OptS219
Gene Length (bp)198198
SpeciesEIAVHomo sapiens; African Green Monkey
StrainspSPEIAV19293T; COS-7
CDSatgggagtatttggtaaaggggtaacatggtcagcatcgcattctatgggggaatcccag
ggggaatctcaacccctattacccaacagtcagaaaaatctaagtgtgaggagaacacaa
tgtttcaaccttattgttataataatgacagtaagaacagcatggcagaatcgaaggaag
caagagaccaagaaatga
atgggcgtgttcgggaagggcgtgacctggagcgccagccactccatgggcgagtcccag
ggcgagagccagcccctgctgcccaacagccagaagaacctctccgtgcgccgcacccag
tgcttcaacctgatcgtcatcatcatgacagtgcgcaccgcctggcagaaccgcaggaag
caggagaccaagaagtga
5' End
3' End
Notes
Expression VectorpCI-S2pOptS219
Assay MethodsWestern blot, immunofluorescenceWestern blot, immunofluorescence
Resultsprotein expression was undetectableProtein expression was detectable by both western blot and immunofluorescence.
Protein Functionunknown, may interact with Gag
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodOligos were designed to convert codons of the wild-type sequence to codons most frequently used in
mammalian genes as defined by Haas et al. Kozak consensus sequence also included.
Publication Author(s)Yoon, S.; Kingsman, S. M.; Kingsman, A. J.; Wilson, S. A.; Mitrophanous, K. A.
Corresponding AuthorKyriacos Mitrophanous
Corresponding AddressRetrovirus Molecular Biology Group, Department of Biochemistry, University of Oxford, South Parks Road, Oxford OX1 3QU, UK.
Publication Year2000
Publication TitleCharacterization of the equine infectious anaemia virus S2 protein
AbstractS2 is an accessory protein of equine infectious anaemia virus (EIAV), the function of which is unknown. In order to gain insight into the function of S2, the intracellular localization of the protein, its interaction with viral proteins and its incorporation into viral particles have been investigated. Immunolocalization of S2 revealed punctate staining in the cytoplasm and the S2 protein co-precipitated with the EIAV Gag precursor. Despite overexpression of S2 through the use of a codon-optimized sequence, there was no preferential association of S2 with EIAV particles. These data suggest that S2 may function to organize the Gag protein during particle assembly in the cytoplasm but that it is unlikely to be involved in the early stages of the virus life-cycle.
JournalJ Gen Virol. 81(Pt 9): 2189-94.
SummaryThe authors wish to synthesized high levels of equine infectious anaemia virus S2 protein for study and gaining insight to the function of this protein. Oligos were designed to convert codons of the wild-type sequence to codons most frequently used in mammalian genes as defined by Haas et al. Kozak consensus sequence also included. Also, S2 was fused to EGFP for immunofluorescence purposes. Variants that would localize to the nucleus were also synthesized using two different signal peptide sequences. Wild-type protein level were undetectable while expression of recoded S2 could be detected by Western blotting and visualized brightly by fluorescence microscopy. The amount of the protein synthesized was sufficient for the purposes of the authors’ experiment.
Comments
Discussion
PubMed ID10950976
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site