Synthetic Gene DataBase
 

Synthetic Gene 275


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID245275
GenBank AccessionAY255838
GenBank GI30171278
Gene NameIFN-alpha-2BrhIFN-alpha-2B
Gene Length (bp)501450
SpeciesHomo sapiensEscherichia coli
StrainsDH5-alpha
CDSatgtgtgacctaccacaaacccacagcctgggtagcaggaggaccttgatgctcctggcg
cagatgaggagaatctctcttttctcctgcttgaaggacagacatgactttggatttccc
caggaggagtttggcaaccagttccaaaaggctgaaaccatccctgtcctccatgagatg
atccagcagatcttcaacctcttcagcacaaaagactcatctgctgcttgggatgagacc
ctcctagacaaattctacactgaactctaccagcagctgaatgacctggaagcctgtgtg
atacagggggtgggggtgacagagactcccctgatgaaggaggactccattctggctgtg
aggaaatacttccaaagaatcactctctatctgaaagagaagaaatacagcccttgtgcc
tgggaggttgtcagagcagaaatcatgagatctttttctttgtcaacaaacttgcaagaa
agtttaagatctaaagagtaa
atgctgctggcgcagatgcgtcgtatcagcctgtttagctgcctgaaagatcgtcatgat
tttggctttccgcaggaagaatttggcaaccagtttcagaaagcggaaaccatcccggtt
ctgcatgaaatgatccagcagatctttaacctgtttagcaccaaagatagcagcgcggcg
tgggatgaaaccctgctggataaattttataccgaactgtatcagcagctgaacgatctg
gaagcgtgcgttatccagggcgttggcgttaccgaaaccccgctgatgaaagaagatagc
atcctggcggttcgtaaatattttcagcgtatcaccctgtatctgaaagaaaaaaaatat
agcccgtgcgcgtgggaagttgttcgtgcggaaatcatgcgtagctttagcctgagcacc
aacctgcaggaaagcctgcgtagtaagtga
5' End
3' End
NotesNo tests were done with the natural gene.No Accession number or GI was provided. CDS was taken using the oligomers.
Expression VectorpRSETA
Assay MethodsSDS-PAGE, ELISA, Western Blot
ResultsHigh increase (5.2g/L, appx. 3g/L purified)
Protein FunctionTreatment of various disease and diagnostics.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe natural gene was codon optimized based on the codon usage patterns of E. coli.
Publication Author(s)Srivastava, P.; Bhattacharaya, P.; Pandey, G.; Mukherjee, K. J.
Corresponding AuthorK.J. Mukherjee
Corresponding AddressCentre for Biotechnology, Jawaharlal Nehru University, New Delhi-110067, India.
Publication Year2005
Publication TitleOverexpression and purification of recombinant human interferon alpha2b in Escherichia coli
AbstractOverexpression of rhIFN-alpha2b was obtained by synthesizing a codon optimized gene for IFN-alpha2b and expressing it in the form of inclusion bodies (IBs) in Escherichia coli. The recombinant plasmid pRSET-IFNalpha, which had the IFN-alpha2b gene under the T7 promoter, was coexpressed with plasmid pGP1-2, which carried the gene for T7 RNA polymerase under the heat inducible lambdaP(L) promoter. This two plasmid expression system was optimized with respect to heat shock time, media, and time of induction in shake flask cultures. This was then scaled up into a bioreactor to get a maximum volumetric product yield of 5.2g/L at a final OD(600) of 67. At this point, the IBs represented approximately 40% of the total cellular protein. This high specific product yields eased the further downstream processing steps and improved product recoveries. The IBs were isolated and purified through ion exchange followed by step refolding to give a final product yield of approximately 3g/L, which is maximum reported in the literature. The bioassay of the refolded protein gave a specific activity of approximately 3 x 10(9)IU/mg protein.
JournalProtein Expr Purif. 41(2): 313-22.
SummaryEscherichia coli (E. coli) was transformed with a recoded version of the IFN-alpha-2B, rhIFN-alpha-2B, in order to increase the expression of Interferon-alpha 2 protein. IFN-alpha-2B was fully codon optimized based on the codon usage patterns of E. coli. As expected, the protein expression of the recoded gene, rhIFN-alpha-2B, had a high increase and can be considered overall, very successful.
CommentsThis study had the highest yield and was the most successful out of any previous similar studies.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=691
PubMed ID15866717
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site