Synthetic Gene DataBase
 

Synthetic Gene 276


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID246276
GenBank AccessionM12799
GenBank GI144968
Gene Name2,5-DKGR A,Bsynthetic 2,5-DKGR A,B
Gene Length (bp)8370
SpeciesCorynebacterium sp.Escherichia coli
StrainsBL21
CDSatgacagttcccagcatcgtgctcaacgacggcaattccattccccagctcgggtacggc
gtcttcaaggtgccgccggcggacacccagcgcgccgtcgaggaagcgctcgaagtcggc
taccggcacatcgacaccgcggcgatctacggaaacgaagaaggcgtcggcgccgcgatc
gcggcgagcggcatcgcgcgcgacgacctgttcatcacgacgaagctctggaacgatcgc
cacgacggcgatgagcccgctgcagcgatcgccgagagcctcgcgaagctggcactcgat
caggtcgacctgtacctcgtgcactggccgacgcccgccgccgacaactacgtgcacgcg
tgggagaagatgatcgagcttcgcgcagccggtctcacccgcagcatcggcgtctcgaac
cacctcgtgccgcacctcgagcgcatcgtcgccgccaccggcgtcgtgccggcggtgaac
cagatcgagctgcaccccgcctaccagcagcgcgagatcaccgactgggccgccgcccac
gacgtgaagatcgaatcgtgggggccgctcggtcagggcaagtacgacctcttcggcgcc
gagcccgtcactgcggctgccgccgcccacggcaagaccccggcgcaggccgtgctccgt
tggcacctgcagaagggtttcgtggtcttcccgaagtcggtccgccgcgagcgcctcgaa
gagaacctcgacgtgttcgacttcgacctcaccgacaccgagatcgccgcgatcgacgcg
atggatccgggcgacggttcgggtcgcgtgagcgcacaccccgatgaggtcgactga
5' End
3' End
NotesAccession number and CDS taken from NCBICorresponding Author was contacted on 5/27/06 for recoded gene CDS
Expression VectorpET21
Assay MethodsSDS-PAGE
ResultsUnable to testHigh levels of synthetic 2,5-DKGR A,B were found in E. Coli
Protein FunctionCatalyzes 2,5-diketo-D-gluconic acid to 2-keto-L-gluconic acid
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons from the wild type gene were removed and/or modified based on the highly expressed codon
usage patterns of E. coli. This was in an attempt to reduce the G+C content, resulting in a decrease
of G+C content from 68% to 55% in version A and 71% to 58% in B.
Publication Author(s)Sanli, G.; Blaber, S. I.; Blaber, M.
Corresponding AuthorMichael Blaber
Corresponding AddressInstitute of Molecular Biophysics and Department of Chemistry, Florida State University, Tallahassee, 32306-3015, USA.
Publication Year2001
Publication TitleReduction of wobble-position GC bases in Corynebacteria genes and enhancement of PCR and heterologous expression
AbstractCorynebacteria codon usage exhibits an overall GC content of 67%, and a wobble-position GC content of 88%. Escherichia coli, on the other hand has an overall GC content of 51%, and a wobble-position GC content of 55%. The high GC content of Corynebacteria genes results in an unfavorable codon preference for heterologous expression, and can present difficulties for polymerase-based manipulations due to secondary-structure effects. Since these characteristics are due primarily to base composition at the wobble-position, synthetic genes can, in principle, be designed to eliminate these problems and retain the wild-type amino acid sequence. Such genes would obviate the need for special additives or bases during in vitro polymerase-based manipulation and mutant host strains containing uncommon tRNA's for heterologous expression. We have evaluated synthetic genes with reduced wobble-position G/C content using two variants of the enzyme 2,5-diketo-D-gluconic acid reductase (2,5-DKGR A and B) from Corynebacterium. The wild-type genes are refractory to polymerase-based manipulations and exhibit poor heterologous expression in enteric bacteria. The results indicate that a subset of codons for five amino acids (alanine, arginine, glutamate, glycine and valine) contribute the greatest contribution to reduction in G/C content at the wobble-position. Furthermore, changes in codons for two amino acids (leucine and proline) enhance bias for expression in enteric bacteria without affecting the overall G/C content. The synthetic genes are readily amplified using polymerase-based methodologies, and exhibit high levels of heterologous expression in E. coli.
JournalJ Mol Microbiol Biotechnol. 3(1): 123-6.
SummaryE. coli was transformed with a recoded versions of the 2,5-DKGR A,B genes, synthetic 2,5-DKGR A,B, in order to increase the expression of 2,5-diketo-D-gluconic acid reductase. Codons in the wild type 2,5-DKGR A,B were modified to fit the codon usage patterns of E. coli. Synthetic 2,5-DKGR A,B produced a much more higher yield of 2,5-diketo-D-gluconic acid reductase than the wild-type gene. It can then be concluded that the recoding process was very successful in achieving its goal of obtaining a high yield.
CommentsCorresponding Author was contacted on 5/27/06 for recoded gene CDS
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=712
PubMed ID11200224
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site