Synthetic Gene DataBase
 

Synthetic Gene 279


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID247279
GenBank AccessionL18983.1
GenBank GI662362
Gene NameIA-2icIA-2ic(AD/DG)H6
Gene Length (bp)29401128
SpeciesHomo sapiensE. coli
StrainsBL21(DE3)pLysS
CDSatgcggcgcccgcggcggcctgggggtctcgggggatccgggggtctccggctgctcctc
tgcctcctgctgctgagcagccgcccggggggctgcagcgccgttagtgcccacggctgt
ctatttgaccgcaggctctgctctcacctggaagtctgtattcaggatggcttgtttggg
cagtgccaggtgggagtggggcaggcccggccccttttgcaagtcacctccccagttctc
caacgcttacaaggtgtgctccgacaactcatgtcccaaggattgtcctggcacgatgac
ctcacccagtatgtgatctctcaggagatggagcgcatccccaggcttcgccccccagag
ccccgtccaagggacaggtctggcttggcacccaagagacctggtcctgctggagagctg
cttttacaggacatccccactggctccgcccctgctgcccagcatcggcttccacaacca
ccagtgggcaaaggtggagctggggccagctcctctctgtcccctctgcaggctgagctg
ctcccgcctctcttggagcacctgctgctgcccccacagcctccccacccttcactgagt
tacgaacctgccttgctgcagccctacctgttccaccagtttggctcccgtgatggctcc
agggtctcagagggctccccagggatggtcagtgtcggccccctgcccaaggctgaagcc
cctgccctcttcagcagaactgcctccaagggcatatttggggaccaccctggccactcc
tacggggaccttccagggccttcacctgcccagctttttcaagactctgggctgctctat
ctggcccaggagttgccagcacccagcagggccagggtgccaaggctgccagagcaaggg
agcagcagccgggcagaggactccccagagggctatgagaaggaaggactaggggatcgt
ggagagaagcctgcttccccagctgtgcagccagatgcggctctgcagaggctggccgct
gtgctggcgggctatggggtagagctgcgtcagctgacccctgagcagctctccacactc
ctgaccctgctgcagctactgcccaagggtgcaggaagaaatccgggaggggttgtaaat
gttggagctgatatcaagaaaacaatggaggggccggtggagggcagagacacagcagag
cttccagcccgcacatcccccatgcctggacaccccactgccagccctacctccagtgaa
gtccagcaggtgccaagccctgtctcctctgagcctcccaaagctgccagaccccctgtg
acacctgtcctgctagagaagaaaagcccactgggccagagccagcccacggtggcagga
cagccctcagcccgcccagcagcagaggaatatggctacatcgtcactgatcagaagccc
ctgagcctggctgcaggagtgaagctgctggagatcctggctgagcatgtgcacatgtcc
tcaggcagcttcatcaacatcagtgtggtgggaccagccctcaccttccgcatccggcac
aatgagcagaacctgtctttggctgatgtgacccaacaagcagggctggtgaagtctgaa
ctggaagcacagacagggctccaaatcttgcagacaggagtgggacagagggaggaggca
gctgcagtccttccccaaactgcgcacagcacctcacccatgcgctcagtgctgctcact
ctggtggccctggcaggtgtggctgggctgctggtggctctggctgtggctctgtgtgtg
cggcagcatgcgcggcagcaagacaaggagcgcctggcagccctggggcctgagggggcc
catggtgacactacctttgagtaccaggacctgtgccgccagcacatggccacgaagtcc
ttgttcaaccgggcagagggtccaccggagccttcacgggtgagcagtgtgtcctcccag
ttcagcgacgcagcccaggccagccccagctcccacagcagcaccccgtcctggtgcgag
gagccggcccaagccaacatggacatctccacgggacacatgattctggcatacatggag
gatcacctgcggaaccgggaccgccttgccaaggagtggcaggccctctgtgcctaccaa
gcagagccaaacacctgtgccaccgcgcagggggagggcaacatcaaaaagaaccggcat
cctgacttcctgccctatgaccatgcccgcataaaactgaaggtggagagcagcccttct
cggagcgattacatcaacgccagccccattattgagcatgaccctcggatgccagcctac
atagccacgcagggcccgctgtcccataccatcgcagacttctggcagatggtgtgggag
agcggctgcaccgtcatcgtcatgctgaccccgctggtggaggatggtgtcaagcagtgt
gaccgctactggccagatgagggtgcctccctctaccacgtatatgaggtgaacctggtg
tcggagcacatctggtgcgaggactttctggtgcggagcttctacctgaagaacgtgcag
acccaggagacgcgcacgctcacgcagttccacttcctcagctggccggcagagggcaca
ccggcctccacgcggcccctgctggacttccgcaggaaggtgaacaagtgctaccggggc
cgctcctgccccatcatcgtgcactgcagtgatggtgcggggaggaccggcacctacatc
ctcatcgacatggtcctgaaccgcatggcaaaaggagtgaaggagattgacatcgctgcc
accctggagcatgtccgtgaccagcggcctggccttgtccgctctaaggaccagtttgaa
tttgccctgacagccgtggcggaggaagtgaatgccatcctcaaggccctgccccagtga
5' Endcagcccctctggcaggctcccgccagcgtcgctgcggctccggcccgggagcgagcgccc
ggagctcggaaag
3' Endgaccctggggccccttggcgggcagcccagcctctgtccctctttgcctgtgtgagcatc
tctgtgtacccactcctcactgccccaccagccacctcttgggcatgctcagcccttcct
agaagagtcaggaagggaaagccagaaggggcacgcctgcccagcctcgcatgccagagc
ctggggcatcccagagcccagggcatcccatgggggtgctgcagccaggaggagaggaaa
ggacatgggtagcaattctacccagagccttctcctgcctacattccctggcctggctct
cctgtagctctcctggggttctgggagttccctgaacatctgtgtgtgtccccctatgct
ccagtatggaagaatggggtggagggtcgccacacccggctccccctgcttctcagcccc
gggcctgcctctgactcacacttgggcgctctgccctccctggcctcacgcccagcctgg
tcccaccaccctcccaccatgcgctgctcaacctctctccttctggcgcaagagaacatt
tctagaaaaaactacttttgtaccagtgtgaataaagttagtgtgttgtctgtgcagctg
NotesThe sequence above shows the entire IA-2 coding sequence, not just the intracellular cellular domain cloned in this paper. The protein is referred to as IA-2ic and is composed of aa residues 604-979.
Expression VectorpTICApTICAγ(AD/DG)H6
Assay MethodsWestern blot, Radio-binding assay, FPLCWestern Blot
Resultsvery poor protein yieldprotein expression as high as with pTICAγ H6, 80 mg/L
Protein Functionantigen of auto-immune diabetes, no natural enzyme activity
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding Methodboth AGG codons replaced with CGT, Ala-877-Asp, Asp-911-Gly (IA-2ic gains phosphatase activity)
Publication Author(s)Sica, M. P.; Primo, M. E.; Ermacora, M. R.; Poskus, E.
Corresponding AuthorMario R. Ermácora
Corresponding AddressSchool of Pharmacy and Biochemistry, University of Buenos Aires and IDEHU-CONICET, Buenos Aires, Argentina.
Publication Year2003
Publication TitleHigh-yield expression of properly folded insulinoma-associated protein intracellular domain (IA-2ic) in Escherichia coli
AbstractThe intracellular domain of insulinoma-associated protein (IA-2), IA-2ic, is a prominent antigen in autoimmune diabetes, and autoantibodies to it are early markers of the disease. The high-yield expression of properly folded IA-2ic is needed for basic research and crucial for low-cost immunoassays aimed at the detection of these autoantibodies in diagnostic and preventive medicine. In previous work, the expression of IA-2ic fused to glutathione S-transferase or to a biotinylatable peptide was reported; however, these methods had very poor yield. Here we show that, utilizing a codon-optimized gene, up to 80 mg of pure and properly folded autoantigen per litre of Escherichia coli culture may be obtained. Furthermore, the addition of a C-terminal His-tag greatly facilitates IA-2ic purification without compromising either its immunoreactivity or its expression yield. To take advantage of the recombinant antigen, an enzyme immunoassay format was developed which proved to be highly specific and sensitive.
JournalBiotechnol Appl Biochem. 37(Pt 3): 301-9.
SummaryThe authors wish to generate high-yield expression of active IA-2ic, insulinoma-associated protein’s intracellular domain, an important antigen of auto-immune diabetes, for research and immunoassays. Previous GST fused IA-2ic had very poor yield. Through codon optimization by converting two rare AGG codons to CGT by site directed mutagenesis, up to 80 mg of pure and properly folded protein per liter of E. coli culture was expressed. A C-terminal his-tag was used for purification without detectably compromising immunoreactivity. The expression of protein was extremely successful, and the His-tag greatly facilitated the purification of protein from the cellular environment. A variation of IA-2ic was also created which restored the natural protein’s phosphotase activity. Initial analysis of the two proteins showed similar structure and levels of heterologous protein expression in E. coli.
Comments
Discussion
PubMed ID12515576
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site