Synthetic Gene DataBase
 

Synthetic Gene 28


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID2128
GenBank AccessionAF493943AF502559
GenBank GI2781833433323476
Gene NameArt v 1 precursorhumArt
Gene Length (bp)399330
SpeciesArtemisia vulgarisHomo sapiens
StrainsB16 mouse melanoma cells
CDSatggcaaagtgttcatatgttttctgtgcggttcttctgattttcatagttgctatcgga
gaaatggaggccgctggttcaaagttgtgtgaaaagacaagcaagacgtattcgggtaag
tgcgacaacaagaaatgtgacaaaaagtgtatagagtgggagaaagcgcaacatggtgct
tgtcacaagagagaagccggcaaagaaagttgcttttgctactttgactgttccaaatcg
cctcctggagcaacaccagcgcctcctggtgcagctcctcccccagctgctggcggctct
ccgtcacctcccgctgatggtggctcaccacctcctccagctgatggtggatctcctcct
gtagatggtggctctccacctcctccgtccactcactaa
atggctggttcaaagttgtgtgaaaagacaagcaagacgtattcgggtaagtgcgacaac
aagaaatgtgacaaaaagtgtatagagtgggagaaagcgcaacatggtgcttgtcacaag
agagaagccggcaaagaaagttgcttttgctactttgactgttccaaatcgcctcctgga
gcaacaccagcgcctcctggtgcagctcctcccccagctgctggcggctctccgtcacct
cccgctgatggtggctcaccacctcctccagctgatggtggatctcctcctgtagatggt
ggctctccacctcctccgtccactcactaa
5' Endagcgtttgttgttcgatcagcatcgtcataattcaaaaagcgtttgttgttcgatcagcatcgtcataattcaaaa
3' Endggaattgatcagtatcttgattattctccttgaataactagacttacaagaatatgaata
aaatgatgttgctacacacgagcatatcatatttgagcatttcctagttaaaagtgtaac
ttgtgttggacgtgtaatgatcaatagcttataattctatgaaataactgtttcaataaa
aaaaaaa
ggaattgatcagtatcttgattattctccttgaataactagacttacaagaatatgaata
aaatgatgttgctacacacgagcatatcatatttgagcatttcctagttaaaagtgtaac
ttgtgttggacgtgtaatgatcaatagcttataattctatgaaataactgtttcaataaa
aaaaaaa
Notes
Expression VectorpCMVpCMV
Assay MethodsELISA and Western blotELISA and Western blot
ResultsTrace amount detected180-fold increase in protein yields compared with wild-type
Protein Functionmajor pollen allergen
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodFull optimization of every codon with reference to the human codon usage in CUTG database
Publication Author(s)Bauer, R.; Himly, M.; Dedic, A.; Ferreira, F.; Thalhamer, J.; Hartl, A.
Corresponding AuthorJosef Thalhamer
Corresponding AddressInstitute of Chemistry and Biochemistry, Immunology Group, University of Salzburg Institute of Genetics and General Biology, University of Salzburg, Salzburg, Austria.
Publication Year2003
Publication TitleOptimization of codon usage is required for effective genetic immunization against Art v 1, the major allergen of mugwort pollen
AbstractBACKGROUND: As the major allergen of mugwort pollen, Art v 1 is an important target for specific immunotherapy. However, both recombinant protein as well as a gene vaccine for Art v 1 failed to be immunogenic in mice. In order to improve immunogenicity we focused on genetic immunization because interspecific differences of codon usage have been shown as an obstacle for effective induction of immune responses with gene vaccines encoding infectious pathogens. OBJECTIVE: In order to find out, whether codon usage might also be used to improve genetic immunization with allergen genes, the response against a gene vaccine expressing the wild-type gene of Art v 1 (pCMV-wtArt) was compared with a synthetic codon-optimized vector with human codon usage (pCMV-humArt). METHODS: Balb/c mice were injected intradermally with pCMV-wtArt or pCMV-humArt. In vitro expression levels of both constructs were compared in transfection experiments. Total immunoglobulin G (IgG), IgG1, IgG2a and IgE antibodies were analyzed by enzyme-linked immunosorbent assay and the anaphylactic activity of the sera was determined by allergen-specific degranulation of rat basophil leukemia-2H3 cells. RESULTS: No immune response was detectable with the gene vaccine expressing the wildtype Art v 1, but immunization with pCMV-humArt revealed a strong and allergen-specific induction of antibody responses. The antibodies recognized both the recombinant as well as the purified natural (glycosylated) Art v 1 molecule. The response type was Th1-biased, as indicated by high levels of IgG2a antibodies. Expression analysis with B16 mouse melanoma cells transfected with pCMV-humArt or pCMV-wtArt revealed an impaired expression of the wild-type vector but normal translation after recoding. CONCLUSION: The results demonstrate that optimization of codon usage offers a simple way to improve immunogenicity and therefore should be routinely considered in the development of gene vaccines for the treatment of allergy.
JournalAllergy. 58(10): 1003-10.
SummaryAll codons in a mugwort pollen allergen gene were adapted according to the human preferred codons defined in CUTG database. Interestingly, not only the expression level of this gene was significantly improved (180 fold), but the immunogenicity of the allergen was also enhanced. However, the codon-optimized gene was expressed in mouse cells, which might compromise the conclusion
CommentsThe first 72 nucleotides coding for the signal peptide were not included in the experiments according to Fig. 1
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=520
PubMed ID14510717
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site