Synthetic Gene DataBase
 

Synthetic Gene 280


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID249280
GenBank AccessionL13255
GenBank GI290246
Gene NameFruitfly lachesin mRNALachesin Full Length
Gene Length (bp)21101080
Species Drosophila melanogasterbaby hamster kidney cells
Strains
CDScccgactttcgaactgtgaagttgtctctccggcgcgttatctccgtcttggccaaaact
cgtgactgatcgagagaagaagtctgaaaccagctctgagcgagaagacaagtgtggaga
ctgcagttcagcatccgcgtttgctgtgctcaagaaagaaacggcaatagttgtcttcgg
ttttcttggagacgtcttcgccgcgctctcaccctatctggagaagattgagatcttgga
gcgcagctcttgagaaacactacatatattaaatcgcgcgcttgcagggtgtggtgctaa
aagtcaatttctaagatgtggcggccgagtatctcgaattgcgtgtggagcaccctgctc
ctggccatttttgtgcagcaaacgctggcacagcgaaccccgaccatatcctacatcacg
caggagcagatcaaggatatcggcggcacagtggagttcgattgctccgtccagtatgcc
aaagagtacaacgtgctgttcctgaagacggacagcgatcccgtcttcctctccacgggc
tccacgctggtcatcaaggattcgcgcttctcgctgcgctacgatcccaactcgtccacc
tacaagctgcagatcaaggacatccaggagacggacgcgggcacctacacctgccaggtg
gtgatctccaccgttcacaaagtgagcgccgaagtgaagctatcggtgcgccgtcctccc
gtcatctcggacaactccacgcagtcggtggtggccagcgagggcagcgaggtccagatg
gagtgctacgccagcggctatcccacacccaccatcacctggaggcgcgagaacaatgcc
attctgccaactgatagtgccacctatgtgggcaacaccctgcgcatcaagtcggtgaag
aaggaggatcgcggcacctactactgcgtggccgacaatggagtgagcaagggcgacagg
cgcaacatcaacgtggaggtggagttcgcaccagtgatcaccgtgccgcgtcctcgtctg
ggacaggccctgcagtacgacatggatttggagtgccacattgaggcctatccgccaccg
gccatcgtgtggaccaaggatgacattcagctggccaacaaccagcactacagcatctcg
cactttgccaccgccgacgagtacaccgactcgacgctccgtgtgatcaccgttgagaag
cgccagtacggagattatgtgtgcaaggccaccaatcgctttggagaggcggaggcgcgc
gtcaatctcttcgagacgatcattcccgtgtgcccaccggcctgtggacaggcgtacatc
gccggagccgaggatgtgtccgccacttcgttcgctcttgtgggcatctcggcgcggttg
ctcttcgccagataagccaatgggcccacggccgtcgactccaagcgcttcaggtccaat
ccatcaaccagccctcgaatgcataaaacatatataaaatagatatatcgaaaacaaaca
tcgtgtaaccgcgcaatagatgtctcaaacgatttcggacacaccaacccacatccagtt
ctcagttcgttttgtagcttctgcttcgtttcgtatagtccagccaatttttgtacgtcc
aatattatgtcttaagtagtatgataagtgaagggccaacgataactagactataattta
ttagcaccctagagccgaactcaaattgaaattagactccagcccagccgtaaacgatgc
atttcaccttgatcccgtccgttttgctttctgatctggcacgtatatgttttaaatatt
ttaatctaagcaagatacatcacaagcattccgattttgcttcgacaattgagaggatat
tttatttttatttaataataataacgtacgcaacctatcagctcgacacactattcccca
aaatatctcaaccccatatcgaggcaaaatcatattcgaataaaaaggcaacaaaagttg
tgtacattattagctcataagcacaatgagaaattcttttgaataacaagacatttttac
ccaaatttttgtgtgggtgtgagtaaaatcaactttcgactttgtaacaaaaaaaaagac
aaacgaaaag
atgtggcggccgagtatctcgaattgcgtgtggagcaccctgctcctggccatttttgtg
cagcaaacgctggcacagcgaaccccgaccatatcctacatcacgcaggagcagatcaag
gatatcggcggcacagtggagttcgattgctccgtccagtatgccaaagagtacaacgtg
ctgttcctgaagacggacagcgatcccgtcttcctctccacgggctccacgctggtcatc
aaggattcgcgcttctcgctgcgctacgatcccaactcgtccacctacaagctgcagatc
aaggacatccaggagacggacgcgggcacctacacctgccaggtggtgatctccaccgtt
cacaaagtgagcgccgaagtgaagctatcggtgcgccgtcctcccgtcatctcggacaac
tccacgcagtcggtggtggccagcgagggcagcgaggtccagatggagtgctacgccagc
ggctatcccacacccaccatcacctggaggcgcgagaacaatgccattctgccaactgat
agtgccacctatgtgggcaacaccctgcgcatcaagtcggtgaagaaggaggatcgcggc
acctactactgcgtggccgacaatggagtgagcaagggcgacaggcgcaacatcaacgtg
gaggtggagttcgcaccagtgatcaccgtgccgcgtcctcgtctgggacaggccctgcag
tacgacatggatttggagtgccacattgaggcctatccgccaccggccatcgtgtggacc
aaggatgacattcagctggccaacaaccagcactacagcatctcgcactttgccaccgcc
gacgagtacaccgactcgacgctccgtgtgatcaccgttgagaagcgccagtacggagat
tatgtgtgcaaggccaccaatcgctttggagaggcggaggcgcgcgtcaatctcttcgag
acgatcattcccgtgtgcccaccggcctgtggacaggcgtacatcgccggagccgaggat
gtgtccgccacttcgttcgctcttgtgggcatctcggcgcggttgctcttcgccagataa
5' End
3' End
Notes
Expression Vector
Assay Methods
Results
Protein Function
Recoding PurposeTo improve expression
Synthesized By
Recoding Method
Publication Author(s) Karlstrom RO, Wilder LP, Bastiani MJ
Corresponding Author Bastiani MJ
Corresponding AddressDepartment of Biology, University of Utah, Salt Lake City 84112
Publication Year1993
Publication TitleLachesin: an immunoglobulin superfamily protein whose expression correlates with neurogenesis in grasshopper embryos.
AbstractWe describe the developmental expression in grasshopper (Schistocerca americana) and molecular characterization in grasshopper and fruit fly (Drosophila melanogaster) of Lachesin, a novel immunoglobulin superfamily protein. Lachesin is expressed on the surfaces of differentiating neuronal cells from the onset of neurogenesis in both the central and peripheral nervous systems. Lachesin expression begins in some cells of the neurogenic ectoderm immediately after engrailed expression begins in the posterior cells of each future segment. All neurogenic cells express Lachesin early, but only those cells that become neuroblasts continue to express Lachesin. Ectodermal cells in the neurogenic region that adopt non-neuronal fates lose Lachesin at the time that they diverge from a potentially neurogenic pathway. Neuroblasts, ganglion mother cells and neurons all express Lachesin early in their lives, but expression becomes restricted to a subset of neurons as development progresses. Sensory neurons express Lachesin as they delaminate from the body wall ectoderm. Lachesin is also present on growing axons of the CNS and PNS and becomes restricted to a subset of axons later in development. This expression is unique among known insect neurogenic genes and suggests a role for Lachesin in early neuronal differentiation and axon outgrowth. Grasshopper Lachesin is a 38 x 10(3) M(r) protein linked to cell membranes through a glycosyl phosphatidylinositol anchor. We have cloned the Lachesin gene from both grasshopper and fly. The proteins are highly conserved (70% identical) between the two species. Lachesin is similar to Drosophila amalgam, bovine OBCAM and the human poliovirus receptor, putting it into a subgroup of the immunoglobulin superfamily containing one V- and two C2-type immunoglobulin domains. Lachesin is also similar to several other vertebrate immunoglobulin superfamily proteins (TAG-1, F11, L1 and NgCAM) known to function in neurite outgrowth and other cell surface recognition events.
JournalDevelopment. 118(2): 509-522.
Summary
Comments
Discussion
PubMed ID8223276
Submitter NameOdegard, Amy
Submitter AddressThe Scripps Research Institute, 10550 N Torrey Pines Rd, La Jolla, CA 92037, USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site