Synthetic Gene DataBase
 

Synthetic Gene 29


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID2229
GenBank AccessionK02718AF373107
GenBank GI33303120385549
Gene NameE7eE7
Gene Length (bp)297321
SpeciesHuman papillomavirusHomo sapiens
Strainstype 16HeLa cells
CDSatgcatggagatacacctacattgcatgaatatatgttagatttgcaaccagagacaact
gatctctactgttatgagcaattaaatgacagctcagaggaggaggatgaaatagatggt
ccagctggacaagcagaaccggacagagcccattacaatattgtaaccttttgttgcaag
tgtgactctacgcttcggttgtgcgtacaaagcacacacgtagacattcgtactttggaa
gacctgttaatgggcacactaggaattgtgtgccccatctgttctcagaaaccataa
atgcacggcgacacccccaccttgcacgagtacatgttggacttgcagcccgagaccacc
gacctgtactgctacgagcagttgaacgacagctccgaggaggaggacgagatcgacggc
cccgccggccaggccgagcccgaccgcgcccactacaacatcgtgaccttctgctgcaag
tgcgactccaccctgcgcctgtgcgtgcagagcacccacgtggacatccgcaccttggag
gacctgctgatgggcaccctgggcatcgtgtgccccatctgcagccagaagcccgactac
aaggacgacgacgacaagtaa
5' End
3' End
NotesThe sequence for the wild-type sequences are not mentioned in the paper. Therefore, the sequence in GenBank K02718 was recorded in this databaseThe published recoded gene in Fig. 1C is missing the second codon as compared with AF373107 but contains a FLAG tag in the C-terminus.
Expression VectorpIRES-neo2pIRES-neo2
Assay MethodsELISAELISA
ResultsDetectable but low expression20 to 100 fold increase in expression
Protein FunctionOncogene
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodSynthetic E7 gene exclusively contains codons that are found preferentially in highly expressed
human genes (Haas et al. 1996)
Publication Author(s)Cid-Arregui, A.; Juarez, V.; zur Hausen, H.
Corresponding AuthorAngel Cid-Arregui
Corresponding AddressAngewandte Tumorvirologie, Deutsches Krebsforschungszentrum, D-69120 Heidelberg, Germany. cid@dkfz.de
Publication Year2003
Publication TitleA synthetic E7 gene of human papillomavirus type 16 that yields enhanced expression of the protein in mammalian cells and is useful for DNA immunization studies
AbstractA synthetic E7 gene of human papillomavirus (HPV) type 16 was generated that consists entirely of preferred human codons. Expression analysis of the synthetic E7 gene in human and animal cells showed levels of E7 protein 20- to 100-fold higher than those obtained with wild-type E7. Enhanced expression of E7 protein resulted from highly efficient translation, as well as increased stability of the E7 mRNA due to its codon optimization. Higher levels of E7 protein in cells transfected with synthetic E7 correlated with significant loss of cell viability in various human cell lines. In contrast, lower E7 protein expression driven by the wild-type gene resulted in a slight induction of cell proliferation. Furthermore, mice inoculated with plasmids expressing the synthetic E7 gene produced significantly higher levels of E7 antibodies than littermates injected with wild-type E7, suggesting that synthetic E7 may be useful for DNA immunization studies and the development of genetic vaccines against HPV-16. In view of these results, we hypothesize that HPVs may have retained a pattern of G + C content and codon usage distinct from that of their host cells in response to selective pressure. Thus, the nonhuman codon bias may have been conserved by HPVs to prevent compromising viability of the host cells by excessive viral early protein expression, as well as to evade the immune system.
JournalJ Virol. 77(8): 4928-37.
SummaryAll codons in HPV-16 E7 gene have been fully-optimized, leading to the 20 to 100 fold increase in protein yields.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=521
PubMed ID12663798
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site