Synthetic Gene DataBase
 

Synthetic Gene 30


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID2330
GenBank AccessionAF005495AF277626
GenBank GI311455412231751
Gene NameEnv (gp160)syn.gp160
Gene Length (bp)24632463
Specieshuman immunodeficiency virus (HIV1)Homo sapiens
StrainsType 1293 cells
CDSatgagagtgagggggatgcagaggaattggcagcacttggggaaatggggccttttattc
ctggggatattgataatctgtaatgctgaaaacttgtgggtcacagtctattatggggta
cctgtgtggaaagaagcaaccactactttattctgtgcatcagatgctaaagcatatgaa
aaagaagcacataatgtctgggctacacatgcctgtgtacccacagatcccaatccacaa
gaagtagttctggaaaatgtaacagaaaattttgatatgtggaaaaataacatggtagaa
caaatgcatacagatataatcagtttatgggatcaaagcctgaagccatgtgtgaagtta
accccactctgtgttactttacgttgtagtaatgccactaccaacagtactcaaaacgac
accctgaaggaagagccaggggcaatacaaaactgttctttcaatatgaccacagaagta
agagataagcagctgaaagtacatgcacttttttataggcttgatatagtaccaatcagc
aatgataatagtagcaatgataatagtagcagagaatacaggctaataaattgtaatacc
tcaacccttacacaggcttgtccaaaggtatcttgggatccaattcccatacattattgt
gctccagctgggtatgcgattctaaagtgtaatgataaaaaattcaatgggacggggcca
tgcaggaatgtcagcacagtacaatgtacacatggaattaaaccagtggtatcaactcaa
ttgttgttaaatggcagcctagcagaaaaagatataataatcagatctcaaaatatctca
gataatgcaaaaaccataatagtacaacttaatgtatctgtgccgattaattgtacaaga
cccaacaacaatacaagaaaaagtataccaataggaccaggacgagcattttatacaaca
ggagaaataataggagacatcagaaaggcacattgtaacgttagtggaacaaaatggaat
gagacgttagaaaaggtaagggcaaagttaaagcctcatttccctaatgcaacaataaaa
tttaactcatcctcaggaggggacctagaaattacaatgcatagttttaattgtagagga
gaatttttctactgcaatacatcaggactgtttaatgacacagtagacaatggcactatc
actctcccatgtcgaataaagcaaattgtaaatatgtggcaggaagtggggcgagcaatg
tatgccgctcccattgcaggaaacattacctgtagctcaaatattacaggtctactattg
acaagagatggtggtcagaataatcagacggaggagaccttcagacctgggggaggaaat
atgaaagacaactggagaagtgaattatataaatataaagtagtagaaattgagccatta
ggagtagcacccaccaaggcaaaaagacaagtggtgaagagagaaaaaagagcagtggga
atgggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcgtca
ataacgctgacggcacaggccagacaattattgtctggcatagtgcaacagcagaataat
ttgctgagggctattgaagcgcaacagcatctgttgcagctcacagtctggggcattaaa
cagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctaggg
ctttggggctgctctggaaaactcatctgcaccactgatgtgccctggaactctagttgg
agtaacaaatctcaggagaagatctgggggaacatgacctggatggagtgggaaaaagag
attagcaattactcaaacgaaatatataggttaattgaagagtcgcagaaccagcaggaa
aagaatgaacaagaattattggcattggacaaatgggcaagtctgtggaattggtttgac
atatcaaaatggctgtggtatataaaaatattcataatgatagtaggaggcttgataggc
ttaagaatagtttttgctgtgctttctatagtaaatagagttaggaagggatactcacct
ttgtcattacagacccgcttcccaagcccaagggaacccgacaggcccgaaggaatcgaa
gaaggaggtggagagccaggcaaagacagatccgtgagattagtgaacggattcttagct
cttgtctgggacgacctgaggaacctgtgcctcttcagctaccgccacttgagagacttc
atattaattgcagcgaggattgtggacaggggactgaagagggggtgggaagccctcaaa
cttctggggaatctcgcgctgtattggagtcaggaactaaagaatagtgctattagcttg
cttaataccacagcaatagtagtagctgaggggacagatagagttatagaagctttgcaa
agagcgggtagagctgttcttaacgtacctagaagaataagacagggcttggaaagggct
ttgctataa
gctagcgcggccgaccgcctgtgggtgaccgtgtactacggcgtgcccgtgtggaaggac
gccaccaccaccctgttctgcgccagcgacgccaaggcctacgacaccgaggtgcacaac
gtgtgggccacccacgcgtgcgtgcccaccgaccccaacccccaggaggtggtgctgggc
aacgtgaccgagaacttcaacatgggcaagaacaacatggtggagcagatgcacgaggat
atcatcagcctgtgggaccagagcctgaagccctgcgtgaagctgacccccctgtgcgtg
accctgaactgcaccaagctgaagaacagcaccgacaccaacaacacccgctggggcacc
caggagatgaagaactgcagcttcaacatcagcaccagcgtgcgcaacaagatgaagcgc
gagtacgccctgttctacagcctggacatcgtgcccatcgacaacgacaacaccagctac
cgcctgcgcagctgcaacacatcgatcatcacccaggcctgccccaaggtgagcttcgag
cccatccccatccacttctgcgcccccgccggcttcgccatcctgaagtgcaacaacaag
accttcaacggcaccggcccctgcaccaacgtgagcaccgtgcagtgcacccacggaatt
cgccccgtggtgagcacccagctgctgctgaacggcagcctggccgaggaggaggtggtg
atcagatctgagaacttcaccaacaacgccaagaccatcatcgtgcagctgaacgagagc
gtggagatcaactgcacccgccccaacaacaacacccgcaagagcatccacatcggccct
ggccgcgccttctacaccaccggcgacatcatcggcgacatccgccaggcccactgcaac
atctctagaaccaactggaccaacaccctgaagcgcgtggccgagaagctgcgcgagaag
ttcaacaacaccaccatcgtgttcaaccagagctccggcggcgaccccgagatcgtgatg
cacagcttcaactgcggcggcgagttcttctactgcaacaccacccagctgttcaacagc
acctggaacgagaccaacagcgagggcaacatcactagtggcaccatcaccctgccctgc
cgcatcaagcagatcatcaacatgtggcaggaggtgggcaaggccatgtacgcccccccc
atcggcggccagatcaagtgcctgagcaacatcaccggcctgctgctgacccgcgacggc
ggcagcgacaactcgagcagcggcaaggagattttccgccccggcggcggcgacatgcgc
gacaactggcgcagcgagctgtacaagtacaaggtggtgaagatcgagcccctgggcatc
gcccccaccaaggccaagcgccgcgtggtgcagcgcgagaagcgcgccgtgggcatcggc
gctatgttcctcggcttcctgggcgctgcaggcagcaccatgggcgccgccagcctgacc
ctgaccgtgcaggcccgccagctgctgagcggcatcgtgcagcagcagaacaacctgctg
cgcgccatcgaggcccagcagcacctgctccagctgaccgtgtggggcatcaagcagctc
caggcccgcgtgctggctctagagcgctacctccaggaccagcgcttcctgggcatgtgg
ggctgctccggcaagctgatctgcaccacggccgtgccctggaacgccagctggagcaac
aagaacctgagccagatttgggacaacatgacctggatggagtgggagcgcgagatcagc
aactacaccgagatcatctacagcctgatcgaggagagccagaaccagcaggagaagaac
gagctggacctgctccagctggacaagtgggcaagcttgtggaactggttcaacatcacc
aactggctgtggtacatcaagattttcatcatgatcgtgggcggcctgatcggcctgcgc
atcgtgttcaccgtgctgagcatcgtgaaccgcgtgcgccagggctacagccccctgagc
ttccagacccgcctgcccgtgccccgcggccccgaccgccccgagggcatcgaggaggag
ggcggcgagcgcgaccgcgaccgcagcacccgcctggtgaccggcttcctgcccctgatc
tgggacgacctgcgcagcctgttcctgttcagctaccatcgattgcgcgacctgctgctg
atcgtggcccgcatcgtggagctgctgggccggcgcggctgggagatcctgaagtactgg
tggaacctgctccagtactggagccaggagctgaagaactctgcagtgagcctgctgaac
gccaccgccatcgccgtggccgagggcaccgaccgcgtgatcgaggtggtgcagcgcatc
tggcgcggcatcctgcacatccccacccgaattcgccagggcttcgagcgcgccctgctg
taa
5' End
3' Endggatcc
Notes
Expression VectorWGR7079 (PowderJect)WRG7079
Assay MethodsRIPARIPA
ResultsLow expressionA significantly higher expression is observed than the wild-type gene
Protein FunctionEnvelope potein
Recoding PurposeTo improve expression
Synthesized ByAuthors (Overlapping PCR)
Recoding MethodAll wild-type codons were replaced with codons from highly expressed human genes
Publication Author(s)Corbet, S.; Vinner, L.; Hougaard, D. M.; Bryder, K.; Nielsen, H. V.; Nielsen, C.; Fomsgaard, A.
Corresponding AuthorAnders Fomsgaard
Corresponding AddressDepartment of Virology Statens Serum Institute, DK-2300 Copenhagen, Denmark.
Publication Year2000
Publication TitleConstruction, biological activity, and immunogenicity of synthetic envelope DNA vaccines based on a primary, CCR5-tropic, early HIV type 1 isolate (BX08) with human codons
AbstractSo far codon-optimized HIV-1 envelope genes have been investigated for the T cell line-adapted strain MN, which differs in several aspects from primary isolates. Envelopes of primary isolates may be more relevant for vaccine purposes. This article describes for the first time the engineering and characterization of four ""humanized"" genes encoding the secreted gp120/gp140, or the membrane-bound gp150/gp160, of a primary CCR5 tropic, clade B, clinical isolate HIV-1(BX08). The genes were built in fragments for easy cassette exchange of regions important for immunogenicity, function, and expression. The transcription and expression of the synthetic genes in mammalian cell lines were Rev independent and highly increased. Increased expression of membrane-bound gp160 induced a high cytopathic effect in U87.CD4.CCR5 cells. Gene gun and intramuscular DNA vaccination in mice induced a strong specific cytotoxic T lymphocyte response independent of the gene construct, expression level, or DNA immunization route. In contrast, the highest anti-gp120 antibody levels were induced by synthetic genes encoding the secreted glycoproteins followed by gp160/gp150. Unlike HIV-1(MN), HIV-1(BX08) V3 was not immune dominant. Despite the high antibody response only low and inconsistent neutralizing titers to the homologous HIV-1 isolate were measured. However, neutralization of SHIV89.6P could be obtained. Thus, the neutralizing epitopes on the cell line-adapted SHIV89.6P and HIV-1(MN) may be more antigenically available for the cross-neutralizing antibodies induced. In conclusion, complete ""humanization"" of the DNA vaccine genes failed to induce a consistent neutralizing antibody response, albeit expression and immunogenicity of the primary HIV-1 glycoproteins were greatly improved. Optimization in terms of improving neutralization may require further modifications of the DNA vaccine gene. The synthetic cassette construct described is a convenient tool developed to investigate this further.
JournalAIDS Res Hum Retroviruses. 16(18): 1997-2008.
SummaryEntire gp160 gene sequence has been ""humanized"" with codons preferred in human highly expressed genes. The codon optimization has dramatically increased the expression of gp160 protein
CommentsThe wild-type env gene was provided by Dr. M. Girard (plasmid 133-3(16). Therefore, the sequence of AF005495 was used. However, the leader sequence was deleted from the expression in the paper.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=519
PubMed ID11153083
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site