Synthetic Gene DataBase
 

Synthetic Gene 31


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID2431
GenBank AccessionM62653U73901
GenBank GI1556601658074
Gene NameGreen fluorescent protein (GFP)yEGFP3
Gene Length (bp)717717
SpeciesAequorea victoriaSaccharomyces cerevisiae and Candida albicans
Strainslambda gt10
CDSatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacactt
gtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaaacag
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt
cttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataa
atgtctaaaggtgaagaattattcactggtgttgtcccaattttggttgaattagatggt
gatgttaatggtcacaaattttctgtctccggtgaaggtgaaggtgatgctacttacggt
aaattgaccttaaaatttatttgtactactggtaaattgccagttccatggccaacctta
gtcactactttcggttatggtgttcaatgttttgctagatacccagatcatatgaaacaa
catgactttttcaagtctgccatgccagaaggttatgttcaagaaagaactatttttttc
aaagatgacggtaactacaagaccagagctgaagtcaagtttgaaggtgataccttagtt
aatagaatcgaattaaaaggtattgattttaaagaagatggtaacattttaggtcacaaa
ttggaatacaactataactctcacaatgtttacatcatggctgacaaacaaaagaatggt
atcaaagttaacttcaaaattagacacaacattgaagatggttctgttcaattagctgac
cattatcaacaaaatactccaattggtgatggtccagtcttgttaccagacaaccattac
ttatccactcaatctgccttatccaaagatccaaacgaaaagagagaccacatggtcttg
ttagaatttgttactgctgctggtattacccatggtatggatgaattgtacaaataa
5' Endaagctttattaaa
3' Endctgcag
NotesSource of the wld type GFP gene was not specified in the paper. Therefore, the M62653 was collected.mut3; highly fluorescent mutant when excited at 488nm; contains S65G, S72A mutations near the chromophore; all codons in this version of the GFP gene are optimal for translation in S. cerevisiae and C. albicans
Expression VectorpRC2312MAL (for C.albicans) and pTS210 (for S. cerevisiae)
Assay MethodsWestern blotWestern blot
ResultsModerate expressionSignificant higher expression than wild-type GFP
Protein FunctionReporter gene
Recoding PurposeTo improve expression
Synthesized ByAuthor
Recoding MethodAll codons are optimized with C. albicans preferred codons
Publication Author(s)Cormack, B. P.; Bertram, G.; Egerton, M.; Gow, N. A.; Falkow, S.; Brown, A. J.
Corresponding AuthorBrendan P. Cormack
Corresponding AddressDepartment of Microbiology and Immunology, Stanford University School of Medicine, CA 94305-5402, USA. cormack@cmgm.stanford.edu
Publication Year1997
Publication TitleYeast-enhanced green fluorescent protein (yEGFP)a reporter of gene expression in Candida albicans
AbstractThe green fluorescent protein (GFP) of Aequorea victoria has been developed here as a reporter for gene expression and protein localization in Candida albicans. When wild-type (wt) GFP was expressed in C. albicans, it was not possible to detect fluorescence or a translation product for the wt protein. Since this was probably due in part to the presence of the non-canonical CTG serine codon in the Aequorea sequence, this codon was changed to the leucine codon TTG. C. albicans cells expressing this construct contained GFP mRNA but were non-fluorescent and contained no detectable translation product. Hence a codon-optimized GFP gene was constructed in which all of the 239 amino acids are encoded by optimal codons for C. albicans. In this gene were also incorporated two previously identified mutations in the chromophore that increase GFP fluorescence. C. albicans cells expressing this yeast-enhanced GFP gene (yEGFP3) are fluorescent and contain GFP protein. yEGFP3 can be used as a versatile reporter of gene expression in C. albicans and Saccharomyces cerevisiae and the optimized GFP described here should have broad applications in these and other fungal species.
JournalMicrobiology. 143(2): 303-11.
SummaryFull-optimization was performed to the reported gene against the yeast codon preference. The codon-optimized GFP gene (yEGFP3) exhibited significant higher expression than the wild-type GFP gene both in S. cerevisiae and C. albicans
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=514
PubMed ID9043107
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site