Synthetic Gene DataBase
 

Synthetic Gene 33


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID2633
GenBank Accession
GenBank GI
Gene NameE5 (wt16E5)16E5*
Gene Length (bp)252252
Specieshuman papillomavirus type 16 (HPV16)Homo sapiens
Strainstype 16HFKs and COS-1 cells
CDSatgacaaatcttgatactgcatccacaacattactggcgtgctttttgctttgcttttgt
gtgcttttgtgtgtctgcctattaatacgtccgctgcttttgtctgtgtctacatacaca
tcattaataatattggtattacatttgtggataacagcagcctctgcgtttaggtgtttt
attgtatatattatatttgtttatataccattatttttaatacatacacatgcacgcttt
ttaattacataa
atgacaaatctggatactgcatccacaacactgctggcctgctttctgctgtgcttttgt
gtgctgctgtgtgtctgcctgctgatcaggcccctgctgctgtctgtgtctacatacaca
tccctgatcatcctggtgctgctgctgtggatcacagcagcctctgcctttaggtgtttt
attgtgtatattatctttgtgtatatcccactgtttctgatccatacacatgcacgcttt
ctgattacataa
5' Endttacatggatccgccaccttacatggatccgccacc
3' Endggatccttacatggatccttacat
Notes
Expression VectorLXSN retrovirus vector (Miller and Rosman 1989)LXSN retrovirus vector
Assay MethodsImmunofluorescence microscopy, immunoprecipitation/immunoblottingImmunofluorescence microscopy, immunoprecipitation/immunoblotting
ResultsUndetectable in fibroblasts and weak expression in keratinocytesThe expression of modified E5 protein was 6 to 9 fold higher than that of wild-type E5.
Protein FunctionModulate endosomal pH and signal transduction pathways
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodAll infreqeuntly used codons in E5 were replaced with those more frequently found in mammalian genes
(Ausubel, 1994).
Publication Author(s)Disbrow, G. L.; Sunitha, I.; Baker, C. C.; Hanover, J.; Schlegel, R.
Corresponding AuthorRichard Schlegel
Corresponding AddressDepartment of Pathology, Georgetown University Medical School, Georgetown University Medical Center, Preclinical Science Building, Room GR10C, Washington, DC 20057, USA.
Publication Year2003
Publication TitleCodon optimization of the HPV-16 E5 gene enhances protein expression
AbstractThe human papillomavirus type 16 (HPV-16) E5 protein is an 83-amino-acid, hydrophobic polypeptide that has been localized to intracellular membranes when overexpressed in COS-1 cells. While the HPV-16 E5 protein appears to modulate endosomal pH and signal transduction pathways, genetic analysis of its biological activities has been hampered by low (usually nondetectable) levels of expression in stable cell lines. Sequence analysis of the native HPV-16 E5 gene revealed that infrequent-use codons are used for 33 of its 83 amino acids and, in an effort to optimize E5 expression, we converted these codons to those more common in mammalian genes. The modified gene, 16E5*, generated protein levels that were six- to ninefold higher than those of wild-type HPV-16 E5, whereas the levels of mRNA were unchanged. 16E5* protein was detectable in keratinocytes by immunoblotting, immunoprecipitation, and immunofluorescence techniques and formed disulfide-dependent dimers and higher-order oligomers. Unlike the bovine papillomavirus E5 protein, which is present in the Golgi, 16E5* was localized primarily to the endoplasmic reticulum and its expression reduced the in vitro life span of keratinocytes.
JournalVirology. 311(1): 105-14.
SummaryBecause 33 of 83 codons in wild-type E5 gene were infrequently used in human, these codons were replaced with more common synonymous codons. As a result, the expression of E5 gene increases at 6-9 folds.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=491
PubMed ID12832208
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site