Synthetic Gene DataBase
 

Synthetic Gene 34


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID2734
GenBank AccessionNC_001355
GenBank GI96260530
Gene NameE7hu-mE7
Gene Length (bp)297297
SpeciesHuman papillomavirus (HPV)Homo sapiens, Cercopithecus aethiops
Strainstype 6bCOS-1 cells from green monkey kidney
CDSatgcatggaagacatgttaccctaaaggatattgtattagacctgcaacctccagaccct
gtagggttacattgctatgagcaattagtagacagctcagaagatgaggtggacgaagtg
gacggacaagattcacaacctttaaaacaacatttccaaatagtgacctgttgctgtgga
tgtgacagcaacgttcgactggttgtgcagtgtacagaaacagacatcagagaagtgcaa
cagcttctgttgggaacactaaacatagtgtgtcccatctgcgcaccgaagacctaa
atgcatggcaggcacgtcaccctgaaggacatcgtgctggacctgcagccccccgacccc
gtggggctgcacggctacggccagctggtggacggcggcgaggacgaggtggacgaggtg
gacggccaggactcccagcccctgaagcagcacttccagatcgtgacctgttgctgcgga
tgtgacagcaacgtgcgcctggtggtgcagtgtaccgagaccgacatcagggaggtgcag
cagctgctgctgggcaccctgaacatcgtgtgccccatctgcgcccccaagacctaa
5' Endggtaccccacc
3' Endgaattc
Notes
Expression VectorpcDNA3pcDNA3
Assay MethodsImmunofluorescence analysisImmunofluorescence analysis
ResultsWeak expression in some cells.Enhanced expression in most nuclei of COS-1 Cells.
Protein FunctionOncogene
Recoding PurposeTo improve expression
Synthesized ByShanghai ShengGong Bioengineering Technology Co.
Recoding MethodCodon usage has been optimized according to human codon preference reported by Demers et al. 1996.
Mutations have been introduced at C24G, E26G, S31G and S32G. Kpn I and EcoR I sites were introduced
at 5' and 3', respectively. In addition, a Kozak sequence was added at the 5'.
Publication Author(s)Zhao, W.; Yu, X.; Zhou, Y.; Bian, J.; Jia, J.; Luan, Y.; Qi, M.; Sun, X.; Wang, H.
Corresponding AuthorYu Xiuping
Corresponding AddressDepartment of Microbiology, School of Medicine, Shandong University, Jinan 250012, China.
Publication Year2002
Publication Title[Optimized codon usage enhances the expression and immunogenicity of DNA vaccine encoding the HPV 6b E7 gene]
AbstractOBJECTIVE: To analyze the influence of optimal codon usage on the expression levels and immunogenicity of DNA vaccines, encoding the human papillomavirus type 6b (HPV 6b) E7 gene. METHODS: The full length E7 gene of HPV 6b was modified to substitute human preferred codon for rarely used codon, and three mutations were introduced into the pRB binding site of HPV 6b E7 to eliminate its transformation potential. The codon optimized and mutated E7 gene (hu-mE7) were cloned into the Kpn I and EcoR I site of the pcDNA3 mammalian expression vector, the in vitro expression of the hu-mE7 gene and the immunogenicity of hu-mE7 DNA vaccine were compared with the wt-E7gene. RESULTS: The in vitro expression of pcDNA3-hu-mE7 was much higher than the classical wt-E7 plasmid in monkey COS-1 cell line. Mice immunized intramuscularly with the pcDNA3-hu-mE7 showed that the codon modified E7 gene induced a stronger IFN-gamma ratios than the wt-E7 gene. CONCLUSIONS: These results suggest that the optimized codon usage contributes to the enhancement of gene expression and immunogenicity of HPV 6b E7 gene.
JournalZhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 16(4): 309-11.
SummaryA viral (HPV) gene E7 has been codon-optimized according to human codon preferences and expressed in green monkey COS1 cells. The authors showed that both the in vitro expression and the immunogenicity increased as compared with wild-type E7 gene.
CommentsMutations in amino acids were introduced at C24G, E26G, S31G, and S32G.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=511
PubMed ID12665891
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site