Synthetic Gene DataBase
 

Synthetic Gene 35


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID2835
GenBank AccessionBC062698
GenBank GI385409360
Gene NameAngiogeninhANG
Gene Length (bp)375375
SpeciesHomo sapiensEscherichia coli
StrainsLung tumor A549 cellsDH5a
CDSatgcaggataactccaggtacacacacttcctgacccagcactatgatgccaaaccacag
ggccgggatgacagatactgtgaaagcatcatgaggagacggggcccgacctcaccctgc
aaagacatcaacacatttattcatggcaacaagcgcagcatcaaggccatctgtgaaaac
aagaatggaaaccctcacagagaaaacctaagaataagcaagtcttctttccaggtcacc
acttgcaagctacatggaggttccccctggcctccatgccagtaccgagccacagcgggg
ttcagaaacgttgttgttgcttgtgaaaatggcttacctgtccacttggatcagtcaatt
ttccgtcgtccgtaa
atgcaggacaactcccgttacacacacttcctgacccagcactatgatgccaaaccacag
ggccgggatgacagatactgtgaaagcatcatgaggagacggggcccgacctcaccctgc
aaagacatcaacacatttattcatggcaacaagcgcagcatcaaggccatctgtgaaaac
aagaatggaaaccctcacagagaaaacctaagaataagcaagtcttctttccaggtcacc
acttgcaagctacatggaggttccccctggcctccatgccagtaccgagccacagcgggg
ttcagaaacgttgttgttgcttgtgaaaatggcttacctgtccacttggatcagtcaatt
ttccgtcgtccgtaa
5' Endaagcaaggagatatc
3' Endggatcccg
NotesThe sequence in the paper (Fig.6) is missing a base "A" at the 3'-end (GUACC-->GUACAC).The sequence given in RGDB combines the first 23bp from Fig.6 and the rest in the natural ang gene.
Expression VectorpLDH99pLDH99
Assay MethodsSDS-PAGESDS-PAGE
ResultsNot determinedThe amount of hANG protein is about 30% of total protein (majority in inclusion body).
Protein FunctionAngiogenesis
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe sequences surrounding ATG codon have been optimized to avoid formation of local mRNA secondary
structure.
Publication Author(s)Lu, F.; Yang, H.; Zhao, Z. L.; Chen, N. C.; Chen, S. M.
Corresponding AuthorZhao Zhongliang
Corresponding AddressDepartment of Biochemistry and Molecular Biology, Fourth Military Medical University, Xi'an 710032, China. zlzhao@fmmu.edu.cn
Publication Year2000
Publication TitleCloning and Optimized Expression of Human Angiogenin in E.coli
AbstractAngiogenin(ANG) is an important factor of angiogenesis during different stage of tumor development and exists widely in various tumors. To study the biological funcption and find the antagonistic drugs of angiogenin, the angiogenin was allowed to be expressed by E.coli. By the aid of computer, the sequence around the start codon of angiogenin gene was modified according to local secondary structure. The modified human ang gene was amplified by reverse-transcription polymerase chain reaction from the human lung cancer cell line A549, and inserted into the prokaryotic expression vector pLDH99. After screening, high expression recombinants were obtained, and the expression level of the hANG was about 30% of total bacteria protein by SDS-PAGE. Biological assays indicated that the rhANG could induce new blood vessel formation in CAM in vitro. Our data showed that the recombinant hANG was active and the optimized expression of ang gene was practicable.
JournalSheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai). 32(5): 499-502.
SummaryThis study investigated the effect of modification of the translation initiation region (nucleotides surrounding start codon) on the protein expression. The wild-type ang gene potentially may form a stem loop at the initiation region. The authors modified the nucleotides in this region to remove the mRNA local secondary structure. They found that the mutant protein accounted for 30% of the total protein. It will be more peruasive if they had shown the expression level of the natural gene.
CommentsThe ORF used in this study does not have the first 72 nt in the gene in GenBank (BC062698).
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=512
PubMed ID12058199
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site