Synthetic Gene DataBase
 

Synthetic Gene 36


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID3036
GenBank AccessionAF384048AF384047
GenBank GI1448802714488025
Gene NameIFN-krecombinant IFN-K
Gene Length (bp)624546
SpeciesHomo sapiensEscherichia coli
StrainsKaretinocytesW3110
CDSatgagcaccaaacctgatatgattcaaaagtgtttgtggcttgagatccttatgggtata
ttcattgctggcaccctatccctggactgtaacttactgaacgttcacctgagaagagtc
acctggcaaaatctgagacatctgagtagtatgagcaattcatttcctgtagaatgtcta
cgagaaaacatagcttttgagttgccccaagagtttctgcaatacacccaacctatgaag
agggacatcaagaaggccttctatgaaatgtccctacaggccttcaacatcttcagccaa
cacaccttcaaatattggaaagagagacacctcaaacaaatccaaataggacttgatcag
caagcagagtacctgaaccaatgcttggaggaagacgagaatgaaaatgaagacatgaaa
gaaatgaaagagaatgagatgaaaccctcagaagccagggtcccccagctgagcagcctg
gaactgaggagatatttccacaggatagacaatttcctgaaagaaaagaaatacagtgac
tgtgcctgggagattgtccgagtggaaatcagaagatgtttgtattacttttacaaattt
acagctctattcaggaggaaataa
atgctggattgcaacctgctgaacgttcatctgcgtcgcgtgacctggcagaacctgcgt
cacctgagctctatgagcaactccttcccggttgagtgcctgcgtgaaaacatcgcgttt
gaactgccgcaagaattcctgcaatacacccagccgatgaaacgtgatatcaagaaagcg
ttctacgaaatgtccctgcaggcgttcaacatcttcagccagcacaccttcaaatactgg
aaagaacgtcacctgaaacagatccagatcggtctggatcagcaagcagaatacctgaac
cagtgcctggaagaagacgagaacgaaaacgaagacatgaaagaaatgaaagagaacgaa
atgaaaccgtctgaagcgcgtgttccgcagctgagctctctggaactgcgccgttacttc
caccgcatcgacaacttcctgaaagaaaagaaatactctgactgcgcgtgggaaatcgtg
cgtgtggaaatccgccgttgtctgtactacttctacaaattcaccgctctgttccgtcgc
aaataa
5' Endgtcagtcat
3' Endtaaggtaccatgacc
NotesOnly the mature IFN-k coding region (Leu28-Lys207) was included for codon optimization.
Expression VectorNApHE4
Assay MethodsNASDS-PAGE
ResultsExpression not determined in E. coli. But it is expressed in its native background, human keratinocytes.Although it was not explicitly showed, it appeared that the recombinant IFN-K was successfully expressed in E. coli.
Protein FunctionActivates the interferon-stimulated response signaling pathway
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodons optimized for expression in E. coli. No specific information given in the paper.
Publication Author(s)LaFleur DW, Nardelli B, Tsareva T, Mather D, Feng P, Semenuk M, Taylor K, Buergin M, Chinchilla D, Roshke V, Chen G, Ruben SM, Pitha PM, Coleman TA, Moore PA.
Corresponding AuthorPaul A. Moore
Corresponding AddressHuman Genome Sciences, 9410 Key West Ave., Rockville, MD 20850, USA.
Publication Year2001
Publication TitleInterferon-kappa, a novel type I interferon expressed in human keratinocytes.
AbstractHigh throughput cDNA sequencing has led to the identification of interferon-kappa, a novel subclass of type I interferon that displays approximately 30% homology to other family members. Interferon-kappa consists of 207 amino acids, including a 27-amino acid signal peptide and a series of cysteines conserved in type I interferons. The gene encoding interferon-kappa is located on the short arm of chromosome 9 adjacent to the type I interferon gene cluster and is selectively expressed in epidermal keratinocytes. Expression of interferon-kappa is significantly enhanced in keratinocytes upon viral infection, upon exposure to double-stranded RNA, or upon treatment with either interferon-gamma or interferon-beta. Administration of interferon-kappa recombinant protein imparts cellular protection against viral infection in a species-specific manner. Interferon-kappa activates the interferon-stimulated response element signaling pathway and a panel of genes similar to those regulated by other type I interferons including anti-viral mediators and transcriptional regulators. An antibody that neutralizes the type I interferon receptor completely blocks interferon-kappa signaling, demonstrating that interferon-kappa utilizes the same receptor as other type I interferons. Interferon-kappa therefore defines a novel subclass of type I interferon that is expressed in keratinocytes and expands the repertoire of known proteins mediating host defense.
JournalJ Biol Chem.. 276(43): 39765-71.
SummaryHuman IFN-k gene was codon-optimized for expression in E. coli and it appeared to be successful. However, there was no details on how the codons were optimized.
CommentsThe study itself focused more on the function of IFN-k gene.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=501
PubMed ID11514542
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site