Synthetic Gene DataBase
 

Synthetic Gene 37


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID3137
GenBank AccessionS77842AJ295615
GenBank GI24347910638018
Gene Namelip (lipase)rlip
Gene Length (bp)10951095
SpeciesPseudomonas sp.Escherichia coli
StrainsKWI-56DH5a and BL21 (DE3)
CDSatggccagaacgatgcgttccagggtggtggcaggagcagtggcatgcgcgatgagcatc
gcgccgttcgcggggacgaccgcagtgatgacgctcgcgacgacgcacgcggcgatggcg
gcgaccgcgcccgccgatggctacgcggcgacgcgttatccgatcatcctcgtgcacggg
ctctcgggtaccgacaagtacgccggcgtggtcgagtattggtatggcatccaggaagac
ctgcagcagaacggtgcgaccgtctacgtcgcgaacctgtcggggttccagagcgacgac
ggcgcgaacgggcgcggcgaacagttgctcgcttacgtgaagacggtgctcgcggcgacg
ggcgcgaccaaggtcaatctcgtcggccacagccagggcggcctcacgtcgcgctatgtc
gcggccgtcgcgcccgatctcgtggcgtcggtgacgacgatcggcacgccgcatcgcggc
tccgagtttgccgacttcgtgcagaacgtgctggcgtacgatccgaccgggctttcgtca
tcggtgatcgccgcgttcgtcaatgtgttcggcatcctgacgagcagcagccacaacacg
aaccaggacgcgctcgccgcgctgcagacgctgaccaccgcccgggctgccacgtacaac
cagaactatccgagcgcgggcctgggtgcgccgggcagttgccagaccggcgcgccgacc
gaaaccgtcggcggcaacacgcacctgctgtattcgtgggccggcacggcgatccagccg
acgctttcggtgttcggcatcacgggcgcgaccgacacgagcaccgttccgctcgttgat
ctggcgaacgtgctcgacccgtcgacgctcgcgctgttcggcaccggcacggtgatgatc
aaccgcggctccgggcagaacgacgggctcgtgtcgaagtgcagtgcgctgtacggcaag
gtgctgagtacgagctacaagtggaaccacctcgacgagatcaaccagctgctcggcgtg
cgcggcgcgtatgcggaagatccggtcgcggtgatccgcacgcatgcgaaccggctgaag
ctggcgggcgtgtaa
atggctcgtaccatgcgttctcgtgttgttgctggtgctgttgcttgtgctatgtctatc
gctccgttcgctggtaccaccgctgttatgaccctggctaccacccacgctgctatggct
gctaccgctccggctgacggttacgctgctacgcgttacccgatcatcctggttcacggt
ctgtctggtaccgacaaatacgctggtgttgttgaatactggtacggtatccaggaagac
ctgcaacagaacggtgctaccgtttacgtcgcgaacctgtctggtttccagtctgacgac
ggtgctaacggtcgtggtgaacagctgctggcttacgttaaaaccgttctggctgctacc
ggtgctaccaaagttaacctggttggtcactctcagggtggtctgacctctcgttacgtt
gctgctgttgctccggacctggttgcttctgttaccaccatcggtaccccgcaccgtggt
tctgaatttgctgacttcgttcagaacgttctggcttacgacccgaccggtctgagctct
tctgttatcgctgctttcgtaaacgttttcggtatcctgacctcttcttctcacaacacc
aaccaggacgctctggctgctctgcagaccctgaccaccgctcgtgctgctacctacaac
cagaactacccgtctgctggtctgggtgctccgggttcttgccagaccggtgctccgacc
gaaaccgttggtggtaacacccacctgctgtactcttgggccggtacggctatccagccg
accctgtctgttttcggtatcaccggtgctaccgacacctctaccgttccgctggtagat
ctggctaacgttctggatccgtccaccctggctctgttcggtaccggtaccgttatgatc
aaccgtggttctggtcagaacgacggtctggtttctaaatgctctgctctgtacggtaaa
gttctgtctacctcttacaaatggaaccacctggacgaaatcaaccagctgctgggtgtt
cgtggtgcttacgctgaagacccggttgctgttatccgtacccacgctaaccgtctgaaa
ctggcaggagtttaa
5' End
3' End
Notes
Expression VectorNApCYKWI
Assay MethodsNASDS-PAGE
ResultsExpression not determinedHigh amounts of mature protein (50%) of cell proteins. However, the full-length recombinant lipase gene does not express.
Protein FunctionCatalyzes the hydrolysis of triacylglycerols
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodFirst, codon usgae was optimized for expression in E. coli (Sharp et al, 1988). Second, the GC
content of the lipase gene was lowered from 69% to 57%. Finally, some restriction sites were
introduced.
Publication Author(s)Traub PC, Schmidt-Dannert C, Schmitt J, Schmid RD.
Corresponding AuthorRolf. D. Schmid
Corresponding AddressInstitut fur Technische Biochemie, Universitat Stuttgart, Germany.
Publication Year2001
Publication TitleGene synthesis, expression in E. coli, and in vitro refolding of Pseudomonas sp.KWI 56 and Chromobacterium viscosum lipases and their chaperones.
AbstractPseudomonas lipases are industrially used as detergent additives, in the food industry, and in organic synthesis. Currently, these lipases are either isolated from wild-type strains or overexpressed in recombinant Pseudomonas host strains which may be subject to special safety regulations and thus be unsuitable for enzyme engineering via directed evolution. Here we describe the heterologous expression of two Pseudomonas lipases in Escherichia coli. The lipase genes of Pseudomonas sp. KWI 56 (recently reclassified as Burkholderia cepacia) and Chromobacterium viscosum and the genes of their specific chaperones, which are required for correct folding, were synthesized with an optimized nucleotide sequence and overexpressed (up to 50%) in E. coli. However, both lipases were inactively expressed inside inclusion bodies. Quantitative in vitro refolding of the lipases in the presence of their specific chaperones yielded 310,000 U/g (Pseudomonas sp. KWI 56) and 190,000 U/g (C. viscosum) wet cells. In addition, these lipases could be demonstrated to refold efficiently in the presence of chaperones of related lipases.
JournalAppl Microbiol Biotechnol.. 55(2): 198-204.
SummaryLipase and its helper protein (chaperone) in Pseudomonas sp. and C. viscosum were codon optimized for expression in E. coli (rare codons to optimal codons). It appeared that none of the full-length gene could be over-expressed. Interestingly, removing the 5' sequence or replacing it with another leader sequence (e.g. ompA) led to significant increase in expression. This suggests that codon optimization cannot solve the posttranslational problems.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=494
PubMed ID11330714
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site