Synthetic Gene DataBase
 

Synthetic Gene 38


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID3238
GenBank AccessionS77842AJ295615
GenBank GI24347910638018
Gene Nameact (activator)act
Gene Length (bp)10351035
SpeciesPseudomonas sp.Escherichia coli
StrainsKWI-56BL21 (DE3)
CDSatgacgtcacgtgaaggacgcgcgccgctggcgcggcgcgccgtggtctatggtgtcgtg
gggctggcggcgattgccggcgtggcgatgtggagcggcgcgggctggcatcgcgcaacg
ggcgcttccggcgagtcgccggaggcgtcggtggcagggggatcggttaccgcaccgccg
caggcagccgtgccggcaagcacgggcttgccgccgtcactcgccggctccagcgcgccg
cggttgccgctcgatgccggcgggcatctcgcgaagtcgcgcgcagtgcgggatttcttc
gactactgcctcaccgcgcagagcgacctgagcgcggccggtctcgacgcgttcgtcatg
cgcgagattgccgcacagctcgacggtaccgttgcgcaagccgaggcgctcgacgtgtgg
caccggtatcgcgcgtatctcgacgcactcgcgaaattgcgcgatgccggcgcggccgac
aagtccgacctgggcgcgttgcaactcgcgctcgaccagcgcgcgtcgatcgcgtaccgc
acgctcggcgactggagccagccgttcttcggtgcggagcagtggcggcagcgctacgac
ctggcgcgactgaagatcgcgcaggatcccacgctgacggatgcgcagaaggccgaacgg
ctcgcggcgctcgaacagcagatgccggccgacgaacgcgccgcgcagcagcacatcgac
cagcagcgtgcggcgatcgaccagatcgcgcaattgcagaagagcggggcgacacccgat
gcgatgcgcgcacaactgacgcagacgctcggccccgaagcggccgcgcgcgtcgcgcag
atgcagcaggacgacgcatcgtggcagagccgctacgcggactatgcggcgcagcgcacg
cagatcgaatcggccggcctgtcgccgcaggatcgcgacgcgcagatcgccgcgctgcgg
cagcgcgtgttcacgcggcccggcgaagccgtgcgtgcggcatcgctcgatcgcggggcg
ggcagcgcgcggtaa
atgacctcccgggaaggtcgtgctccgctggctcgtcgtgctgttgtttacggtgttgtt
ggtctggctgctatcgctggtgttgctatgtggtctggtgctggttggcaccgtgctacc
ggtgcttctggtgaatctccggaagcatctgttgctggtggttctgttaccgctccgccg
caggctgctgttccggcttctaccggtctgccgccgtctctggctggttcttctgctccg
cgtctgccgctggacgctggtggtcacctggctaaatctcgtgctgttcgtgacttcttc
gactactgcctgaccgctcagtctgacctgtccgcggctggtctggacgctttcgttatg
cgtgaaatcgctgctcagctggacggtaccgttgctcaggctgaagctctggacgtttgg
caccgttaccgtgcttacctggacgctctggctaagcttcgtgacgctggtgctgctgac
aaatctgacctgggtgctctgcaactggctctggaccagcgtgcttctatcgcttaccgt
accctgggtgactggtctcagccgttcttcggcgcggaacagtggcgtcagcgttacgac
ctggctcgtctgaaaatcgctcaggacccgaccctgaccgacgctcagaaagctgaacgt
ctggctgctctcgagcagcagatgccggctgacgaacgtgctgctcagcagcacatcgac
cagcagcgtgctgctatcgaccagatcgctcagctgcaaaaatctggtgctaccccggac
gctatgcgtgctcagctgacccagaccctgggtccggaagcggccgctcgtgttgctcag
atgcagcaggacgacgcttcttggcagtctcgttacgctgactacgctgctcagcgtacc
cagatcgaatctgctggtctgtctccgcaggaccgtgacgctcagatcgctgctctgcgt
cagcgtgttttcacccgtccgggtgaagctgttcgtgctgcttctctcgatcgtggtgct
ggttctgctcgttaa
5' End
3' End
Notes
Expression VectorNApET20b(+)
Assay MethodsNASDS-PAGE
ResultsExpression not determinedThe high yields of soluble chaperone (50%) was achieved when the first 70aa (membrance anchor) were removed or replaced by the ompA signal sequence.
Protein FunctionHelper protein for lipase; Chaperone
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usgae was optimized for expression in E. coli (Sharp et al, 1988).
Publication Author(s)Traub PC, Schmidt-Dannert C, Schmitt J, Schmid RD.
Corresponding AuthorRolf. D. Schmid
Corresponding AddressInstitut fur Technische Biochemie, Universitat Stuttgart, Germany.
Publication Year2001
Publication TitleGene synthesis, expression in E. coli, and in vitro refolding of Pseudomonas sp.KWI 56 and Chromobacterium viscosum lipases and their chaperones.
AbstractPseudomonas lipases are industrially used as detergent additives, in the food industry, and in organic synthesis. Currently, these lipases are either isolated from wild-type strains or overexpressed in recombinant Pseudomonas host strains which may be subject to special safety regulations and thus be unsuitable for enzyme engineering via directed evolution. Here we describe the heterologous expression of two Pseudomonas lipases in Escherichia coli. The lipase genes of Pseudomonas sp. KWI 56 (recently reclassified as Burkholderia cepacia) and Chromobacterium viscosum and the genes of their specific chaperones, which are required for correct folding, were synthesized with an optimized nucleotide sequence and overexpressed (up to 50%) in E. coli. However, both lipases were inactively expressed inside inclusion bodies. Quantitative in vitro refolding of the lipases in the presence of their specific chaperones yielded 310,000 U/g (Pseudomonas sp. KWI 56) and 190,000 U/g (C. viscosum) wet cells. In addition, these lipases could be demonstrated to refold efficiently in the presence of chaperones of related lipases.
JournalAppl Microbiol Biotechnol.. 55(2): 198-204.
SummaryLipase and its helper protein (chaperone) in Pseudomonas sp. and C. viscosum were codon optimized for expression in E. coli (rare codons to optimal codons). It appeared that none of the full-length gene could be over-expressed. Interestingly, removing the 5' sequence or replacing it with another leader sequence (e.g. ompA) led to significant increase in expression. This suggests that codon optimization cannot solve the posttranslational problems.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=494
PubMed ID11330714
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site