Synthetic Gene DataBase
 

Synthetic Gene 4


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID44
GenBank AccessionV00727
GenBank GI50399
Gene Namec-FosM2
Gene Length (bp)11431143
SpeciesMus musculusEscherichia coli
StrainsBL21 (DE3) pLysS
CDSatgatgttctcgggtttcaacgccgactacgaggcgtcatcctcccgctgcagtagcgcc
tccccggccggggacagcctttcctactaccattccccagccgactccttctccagcatg
ggctctcctgtcaacacacaggacttttgcgcagatctgtccgtctctagtgccaacttt
atccccacggtgacagccatctccaccagcccagacctgcagtggctggtgcagcccact
ctggtctcctccgtggccccatcgcagaccagagcgccccatccttacggactccccacc
cagtctgctggggcttacgccagagcgggaatggtgaagaccgtgtcaggaggcagagcg
cagagcatcggcagaaggggcaaagtagagcagctatctcctgaagaggaagagaaacgg
agaatccgaagggaacggaataagatggctgcagccaagtgccggaatcggaggagggag
ctgacagatacactccaagcggagacagatcaacttgaagatgagaagtctgcgttgcag
actgagattgccaatctgctgaaagagaaggaaaaactggagtttattttggcagcccac
cgacctgcctgcaagatccccgatgaccttggcttcccagaggagatgtctgtggcctcc
ctggatttgactggaggtctgcctgaggcttccaccccagagtctgaggaggccttcacc
ctgccccttctcaacgaccctgagcccaagccatccttggagccagtcaagagcatcagc
aacgtggagctgaaggcagaaccctttgatgacttcttgtttccggcatcatctaggccc
agtggctcagagacctcccgctctgtgccagatgtggacctgtccggttccttctatgca
gcagactgggagcctctgcacagcaattccttggggatggggcccatggtcacagagctg
gagcccctgtgtactcccgtggtcacctgtactccgggctgcactacttacacgtcttcc
tttgtcttcacctaccctgaagctgactccttcccaagctgtgccgctgcccaccgaaag
ggcagcagcagcaacgagccctcctccgactccctgagctcacccacgctgctggccctg
tga
atgatgttctcgggtttcaacgccgactacgaggcgtcatcctcccgctgcagtagcgcc
tccccggccggggacagcctttcctactaccattccccagccgactccttctccagcatg
ggctctcctgtcaacacacaggacttttgcgcagatctgtccgtctctagtgccaacttt
atccccacggtgacagccatctccaccagcccagacctgcagtggctggtgcagcccact
ctggtctcctccgtggccccatcgcagaccagagcgccccatccttacggactccccacc
cagtctgctggggcttacgccagagcgggaatggtgaagaccgtgtcaggaggccgcgcg
cagagcatcggcagaaggggcaaagtagagcagctatctcctgaagaggaagagaaacgc
cgtatccgtcgcgaacgtaataagatggctgcagccaagtgccgtaatcgtcgtcgcgag
ctgacagatacactccaagcggagacagatcaacttgaagatgagaagtctgcgttgcag
actgagattgccaatctgctgaaagagaaggaaaaactggagtttattttggcagcccac
cgacctgcctgcaagatccccgatgaccttggcttcccagaggagatgtctgtggcctcc
ctggatttgactggaggtctgcctgaggcttccaccccagagtctgaggaggccttcacc
ctgccccttctcaacgaccctgagcccaagccatccttggagccagtcaagagcatcagc
aacgtggagctgaaggcagaaccctttgatgacttcttgtttccggcatcatctaggccc
agtggctcagagacctcccgctctgtgccagatgtggacctgtccggttccttctatgca
gcagactgggagcctctgcacagcaattccttggggatggggcccatggtcacagagctg
gagcccctgtgtactcccgtggtcacctgtactccgggctgcactacttacacgtcttcc
tttgtcttcacctaccctgaagctgactccttcccaagctgtgccgctgcccaccgaaag
ggcagcagcagcaacgagccctcctccgactccctgagctcacccacgctgctggccctg
tga
5' End
3' End
Notes
Expression VectorpTH6 (from pTD2)pTH6 (derived from pTD2, Deng et al. 1990)
Assay MethodsImmunoblottingSDS-PAGE/Immuoblotting
ResultsUndetectable20% of all bacterial protein (10 times increase)
Protein FunctionOncogene, dimerize with c-Jun to bind TRE
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodSelective (minimal) optimization: 10 ariginine optimized in basic region via mutagenesis.
Specifically: AGA119CGC, CGG140CGC, AGA142CGT, CGA143CGT, AGG144CGC, CGG146CGT, CGG155CGT,
CGG157CGT, AGG158CGT, AGG159CGC
Publication Author(s)Deng, T.
Corresponding Author
Corresponding AddressDepartment of Biochemistry and Molecular Biology, College of Medicine, University of Florida, Gainesville 32610-0245, USA. tdeng@biochem.med.ufl.edu
Publication Year1997
Publication TitleBacterial expression and purification of biologically active mouse c-Fos proteins by selective codon optimization
AbstractA simple strategy using selective codon optimization was devised to express mouse c-Fos protein in high levels in E. coli. Ten arginine codons located in the basic region were optimized to achieve high levels of protein expression. The c-Fos protein was purified to near homogeneity and was demonstrated to be biologically active by assaying its several biological activities.
JournalFEBS Lett. 409(2): 269-72.
SummaryThis paper presents a strategy for expressing a mouse protein (c-Fos) in E. coli. Potentially, this strategy can be applicable to other mammalian genes. c-Fos protein is part of a dimer that makes up activator protein (AP-1) and binds to the TPA response element (TRE). Unaltered mouse c-Fos DNA (CAI = 0.239) had undetectable expression in E. coli, presumably due to the presence of multiple rare Arg codons. Two approaches were used to optimize the codon usage of c-Fos for high levels of expression in E. coli. 1) Five Arg codons (at codon position 140, 142,143,144 and 146) were optimized therefore resulting in the M1 gene (CAI = 0.258); 2) then five additional Arg codons (at codon position 119,155,157,158 and 159) were optimized (M2 gene, CAI = 0.278) using oligodeoxynucleotide mutagenesis. The optimized gene was cloned into pTH6 vector and induced with IPTG for protein expression. The optimization in M1 gene did not improve the protein expression significantly. However, optimization in M2 increased protein products to comprise approximately 20% of total proteins. All analysis of the protein's properties showed that the c-Fos was biological active. Since replacing 10 Arg codons (minimal optimization) clustered around the functional domain of c-Fos was enough to dramatically increase protein expression, the authors concluded that not all of the rare codons need to be optimized to improve gene expression.
Comments
Discussion
PubMed ID9202159
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site