Synthetic Gene DataBase
 

Synthetic Gene 41


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID3541
GenBank AccessionNM_000515AF205361
GenBank GI208092486671283
Gene NameSomatotropinhST
Gene Length (bp)582582
SpeciesHomo sapiensNicotiana tabacum (common tobacco )
Strainschloroplasts
CDSatggctacaggctcccggacgtccctgctcctggcttttggcctgctctgcctgccctgg
cttcaagagggcagtgccttcccaaccattcccttatccaggctttttgacaacgctatg
ctccgcgcccatcgtctgcaccagctggcctttgacacctaccaggagtttgaagaagcc
tatatcccaaaggaacagaagtattcattcctgcagaacccccagacctccctctgtttc
tcagagtctattccgacaccctccaacagggaggaaacacaacagaaatccaacctagag
ctgctccgcatctccctgctgctcatccagtcgtggctggagcccgtgcagttcctcagg
agtgtcttcgccaacagcctggtgtacggcgcctctgacagcaacgtctatgacctccta
aaggacctagaggaaggcatccaaacgctgatggggaggctggaagatggcagcccccgg
actgggcagatcttcaagcagacctacagcaagttcgacacaaactcacacaacgatgac
gcactactcaagaactacgggctgctctactgcttcaggaaggacatggacaaggtcgag
acattcctgcgcatcgtgcagtgccgctctgtggagggcagctgtggcttctag
atggctttcccgactattccactgagccgcctgttcgacaacgctatgctgcgagctcac
cgtctgcaccagctggctttcgacacctaccaggagttcgaagaagcatacatcccgaaa
gaacagaaatactccttcctgcagaacccgcagacctccctgtgcttctccgaaagcatt
ccgaccccgagcaaccgcgaagaaacccagcagaaatccaacctcgagctgctgcgtatc
tccctgctgctgattcaatcctggctggaaccagttcagttcctgcgttccgttttcgct
aactcactagtttatggcgcttccgactccaacgtttacgacctgctgaaggacctggaa
gaaggtattcagactctgatgggtcgtctggaggacggttcccctaggaccggtcagatc
ttcaaacagacctatagcaaattcgacaccaactcccacaacgacgacgcgttgctgaaa
aactacggtctgctgtactgcttccggaaggacatggacaaggttgagactttcctgcgt
atcgttcagtgccgttccgttgaaggttcctgcggtttctaa
5' End
3' End
NotesThe hST gene was also fused with ubiquitin at the 5' end. See AF205360
Expression Vectorwrg4838pPRV
Assay MethodsNAWestern blot
ResultsExpression not determined because no attempt was made to obtain a transgenic plant that carries a natural hST gene.>7% total soluable proteins were somatotropin.
Protein FunctionGrowth hormone
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodE. coli preferred codons were used.
Publication Author(s)Staub JM, Garcia B, Graves J, Hajdukiewicz PT, Hunter P, Nehra N, Paradkar V, Schlittler M, Carroll JA, Spatola L, Ward D, Ye G, Russell DA.
Corresponding AuthorJeffery M. Staub
Corresponding AddressMonsanto Company, 700 Chesterfield Village Parkway North, St. Louis, MO 63198, USA.
Publication Year2000
Publication TitleHigh-yield production of a human therapeutic protein in tobacco chloroplasts.
AbstractTransgenic plants have become attractive systems for production of human therapeutic proteins because of the reduced risk of mammalian viral contaminants, the ability to do large scale-up at low cost, and the low maintenance requirements. Here we report a feasibility study for production of a human therapeutic protein through transplastomic transformation technology, which has the additional advantage of increased biological containment by apparent elimination of the transmission of transgenes through pollen. We show that chloroplasts can express a secretory protein, human somatotropin, in a soluble, biologically active, disulfide-bonded form. High concentrations of recombinant protein accumulation are observed (>7% total soluble protein), more than 300-fold higher than a similar gene expressed using a nuclear transgenic approach. The plastid-expressed somatotropin is nearly devoid of complex post-translational modifications, effectively increasing the amount of usable recombinant protein. We also describe approaches to obtain a somatotropin with a non-methionine N terminus, similar to the native human protein. The results indicate that chloroplasts are a highly efficient vehicle for the potential production of pharmaceutical proteins in plants.
JournalNat Biotechnol.. 18(3): 333-8.
SummaryThis study aimed to show plant chloroplasts as a good system for production of human proteins. A version of synthetic somatotropin gene codon optimized for E. coli was used in construction of transgenic lines. Interestingly, it appeared that the transgenic plants successfuly expressed hST proteins.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=495
PubMed ID10700152
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site