Synthetic Gene DataBase
 

Synthetic Gene 42


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID3642
GenBank AccessionY09021AF181866
GenBank GI16540736815282
Gene Namefructosyl amine-oxygen oxidoreductase (FAOP)FAOD
Gene Length (bp)13141314
SpeciesPenicillium janthinellumCandida boidinii
StrainsAKU3413TK62 (ura3) and aod1-
CDSatggctcattcgcgagaaagcacaaagattgtcattgtcgggggaggtggcacaatggga
tcttcaaccgcgctacacctgatacgctctggatacaccccgtcaaacatcaccgtcctt
gatgtatacccaattccatccttgcaatccgcaggatatgatcttaacaagatcatgagc
atccgattacgcaacgggcctgacttgcaactttccctggaggctctcgatatgtggaaa
aacgatccgttgttcaagcctttctttcacaacgttggcatgctagactgttcatcgtca
caagagggtattgcaagccttcgacggaagcaccaagacctcatagacgcgaatatcgga
ctagagaagacgaatatctggttagagagtgaagatgatattctggcaaaagccccgcac
ttcacgcgggaacagatcaaggggtggaagggcttgttttgcggcgatggaggatggctt
gctgcagccaaggccatcaatgcgatcggaacctttctaaaaagtcaaggcgtcaagttc
ggatttggaagtgccgggactttcaagcgacctttgtttgctccagatggggcgacatgc
agcggtgttgagacagtagatggaacaaaatacttcgccgacaaggtggttttggccgct
ggtgcttggagttcgacgttagtagatttggaggaccaatgtgtttcgaaggcctgggtc
ttcgctcatatccaactcacgccccaagaatcggcccagtacaaggacgtgcccgtagta
tacgacggtgattatggctttttcttcgagcccaacgaacacggagtaatcaaagtctgc
gatgagttccccgggttctcccgcttcaagctgcatcaaccttacggtgccacctctcct
aagcttatatccgttcctcgatcacacgccaagcatcccaccgatacctacccagattct
tctgaagagaccattcgaaaagcgattgcgaggtttatgccacgcttcaaggataaggag
ctttttaataggagcatgtgctggtgcaccgatactgctgatgccaacttgttgatctgc
gagcaccccaagtggaagaactttatcttggccacaggagacagcggccatagtttcaag
gttttgcccaatataggaaaacatgtcgttgagttgatagaaggacgcctaccacaagac
ctggctggtgcgtggagatggagaccagggggagatgcccttaagtccaaacgcagtgct
ccggcaaaggaccttgctgaaatgccgggctggaagcatgatgcgaagctctga
atggctcattctagagaatctactaaaattgttattgttggtggtggtggtactatgggt
tcttctactgctttacatttaattagatctggttatactccatctaatattactgtttta
gatgtttatccaattccatctttacaatctgctggttatgatttaaataaaattatgtct
attagattaagaaatggtccagatttacaattatctttagaagcattagatatgtggaaa
aatgatccattatttaaaccattttttcataatgttggtatgttagattgttcttcttct
caagaaggtattgcttctttaagaagaaaacatcaagatttaattgatgctaatattggt
ttagaaaaaactaatatatggttagaatctgaagatgatatattagctaaagctccacat
tttactagagaacaaataaaaggttggaaaggtttattttgtggtgatggtggttggtta
gctgcagctaaagctataaatgctataggtacttttttaaaatctcaaggtgttaaattt
ggttttggttctgctggtacttttaaaagaccattatttgctccagatggtgctacttgt
tctggtgttgaaactgttgatggtactaaatattttgctgataaagttgttttagctgct
ggtgcttggtcttctactttagttgatttagaagatcaatgtgtttctaaggcttgggtt
tttgctcatatacaattaactccacaagaatctgctcaatataaagatgttccagttgtt
tatgatggtgattatggttttttttttgaaccaaatgaacatggtgttataaaagtttgt
gatgaatttccaggtttttctagatttaaattacatcaaccatatggtgctacttctcca
aagcttatatctgttccaagatctcatgctaaacatccaactgatacttatccagattct
tctgaagaaactataagaaaagctatagctagatttatgccaagatttaaagataaagaa
ttatttaatagatctatgtgttggtgtactgatactgctgatgctaatttattaatatgt
gaacatccaaaatggaaaaattttatattagctactggtgattctggtcattcttttaaa
gttttaccaaatataggtaaacatgttgttgaattaatagaaggtagattaccacaagat
ttagctggtgcttggagatggagaccaggtggtgatgctttaaaatctaaaagatctgct
ccagctaaagatttagctgaaatgccaggttggaaacatgatgctaaattatga
5' End
3' End
NotesThe expression of synthetic FAOD was higher in alcohol oxidase-depleted strain than in wild-type strain.
Expression VectorNApNoteI
Assay MethodsNAWestern blot (Bradford 1976)
ResultsExpression not determinedThe expression of the active form of FAOD in C. boidinii reached as high as 18% of the total soluble protein, in contrasting with the 0.2% in E. coli.
Protein FunctionAmadoriase; Enzymatic determination of the quantity of glycated proteins
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon optimized according to codon preferences in C. boidinii highly expressed genes.
Publication Author(s)Sakai Y, Yoshida H, Yurimoto H, Yoshida N, Fukuya H, Takabe K, Kato N.
Corresponding AuthorYasuyoshi Sakai
Corresponding AddressDivision of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Kitashirakawa-Oiwake, Sakyo-ku, Kyoto, Japan.
Publication Year1999
Publication TitleProduction of fungal fructosyl amino acid oxidase useful for diabetic diagnosis in the peroxisome of Candida boidinii.
AbstractA high-level production of fructosyl amino acid oxidase (FAOD), whose production was toxic in Escherichia coli, was investigated through attempts to utilize the peroxisome of Candida boidinii as the place for protein accumulation. The alcohol oxidase-depleted strain (strain aod1Delta) produced FAOD at a four to five times higher level than the wild type strain in terms of protein amount and enzyme activity, although the transcriptional level was similar. As a result of this study, we could improve FAOD productivity approximately 47-fold from the original transformant, and FAOD accumulated within membrane-bound peroxisomes up to 18% of the total soluble proteins.
JournalFEBS Lett.. 459(2): 233-7.
SummarySince the overexpression of FAOD in E. coli was toxic, this study attempted to find a new system for high production of FAO protein. The FAOD gene was codon optimized for expression in Candida boidinii and successfully expressed at high levels.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=496
PubMed ID10518026
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site