Synthetic Gene DataBase
 

Synthetic Gene 43


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID3743
GenBank AccessionZ48338AJ297962
GenBank GI92752111323291
Gene NamesoxEsoxE
Gene Length (bp)600504
SpeciesSulfolobus acidocaldariusEscherichia coli
StrainsDSM 639BL21 (DE3) pLysS
CDSatgaaggctcaaagttctgttttgcctgttgtagtcggaattttagttgtaataatagca
gtagccgtaggagtttatgtctacaaccaatatgttatgctgtcctcaccctctgctagt
agtagtacaggcacaagtacaggacctagtaaaatctccataccatatagtagtagcaat
aaaactgtttttttgaccatagtagttgaatcttcaagtaacgttaatcagttcaacttt
aatggcacttcatcaggaagcttagtaatatatataccagcaggatctacagtaattgta
aaattcatcaatcaagaatcactgcctcataatcttgtacttttacaaaattccacgcct
acaccacaaagcccagaaataagtagtgatggaaaaataatagacatagtgggtgcaaca
actagcaactacgacgtaaacgggatatcaggaggtgcttcggctgaaggggtatgggga
ccaataagcgcaggggattatatgctagtatgtggaatacttggtcacgctgcttcagga
atgtgggcagttttggtagcctcaaataatgtaacagctccttatgcagtgattgattaa
atggtgagcagcccgagcgcgagcagcagcaccggcaccagcaccggcccgagcaaaatt
agcattccgtatagcagcagcaacaaaaccgtgtttctgaccattgtggtggaaagcagc
agcaacgtgaaccagtttaactttaacggcaccagcagcggcagcctggtgatttatatt
ccggcgggcagcaccgtgattgtgaaatttattaaccaggaaagcctgccgcataacctg
gtgctgctgcagaacagcaccccgaccccgcagagcccggaaattagcagcgatggcaaa
attattgatattgtgggcgcgaccaccagcaactatgatgtgaacggcattagcggcggc
gcgagcgcggaaggcgtgtggggcccgattagcgcgggcgattatatgctggtgtgcggc
attctgggccatgcggcgagcggcatgtgggcggtgctggtggcgagcaacaacgtgacc
gcgccgtatgcggtgattgattaa
5' End
3' End
Notes
Expression VectorNApET15b
Assay MethodsNAWestern blot
ResultsExpression not determined.Successful expression in E. coli.
Protein FunctionSulfocyanin (SynEII, a blue copper protein)
Recoding PurposeTo improve expression
Synthesized ByAuthors (recursive PCR)
Recoding MethodCodon usage optimized for E. coli.
Publication Author(s)Komorowski L, Schafer G.
Corresponding AuthorGunter Schafer
Corresponding AddressInstitute of Biochemistry, Medical University of Lubeck, D-23538, Lubeck, Germany.
Publication Year2001
Publication TitleSulfocyanin and subunit II, two copper proteins with novel features, provide new insight into the archaeal SoxM oxidase supercomplex.
AbstractThe isolation of a fully functional SoxM terminal oxidase supercomplex from the archaeon Sulfolobus acidocaldarius has failed thus far and several of its constituents have only been predicted genetically, such as the small Cu protein sulfocyanin and the subunit II bearing a Cu(A) center. Here we report the recombinant expression of sulfocyanin and prove its transcription in Sulfolobus as well as its presence in the enriched complex. It reveals a redox potential of +300 mV and spectroscopic features that are characteristic of type I copper centers. It is highly thermostable and firmly attached to the complex by one putative transmembrane anchor. Surprisingly, subunit II is completely missing from the isolated complex and behaves as an easily dissociable constituent which is a unique case within the terminal oxidase family. Its loss into the soluble phase upon cell disruption can be considered the reason for the inactivity of the isolated membrane complex.
JournalFEBS Lett.. 487(3): 351-5.
SummaryAn archea gene soxE was codon optimized for expression in E. coli. Western blot detected a strong signal in the extract of E. coli BL21 (DE3) pLys cells.
CommentsThe wild-type soxE gene has 600 bp but the synthetic gene only has 504 bp. Be cautious to compare them.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=497
PubMed ID11163357
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site