Synthetic Gene DataBase
 

Synthetic Gene 46


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID3846
GenBank AccessionAF168419AF506026
GenBank GI710573321464835
Gene NameDsRed (drFP583)tdimer2
Gene Length (bp)6781395
SpeciesDiscosoma sp (coral)Homo sapiens
StrainsHela Cells
CDSatgaggtcttccaagaatgttatcaaggagttcatgaggtttaaggttcgcatggaagga
acggtcaatgggcacgagtttgaaatagaaggcgaaggagaggggaggccatacgaaggc
cacaataccgtaaagcttaaggtaaccaaggggggacctttgccatttgcttgggatatt
ttgtcaccacaatttcagtatggaagcaaggtatatgtcaagcaccctgccgacatacca
gactataaaaagctgtcatttcctgaaggatttaaatgggaaagggtcatgaactttgaa
gacggtggcgtcgttactgtaacccaggattccagtttgcaggatggctgtttcatctac
aaggtcaagttcattggcgtgaactttccttccgatggacctgttatgcaaaagaagaca
atgggctgggaagccagcactgagcgtttgtatcctcgtgatggcgtgttgaaaggagag
attcataaggctctgaagctgaaagacggtggtcattacctagttgaattcaaaagtatt
tacatggcaaagaagcctgtgcagctaccagggtactactatgttgactccaaactggat
ataacaagccacaacgaagactatacaatcgttgagcagtatgaaagaaccgagggacgc
caccatctgttcctttaa
atggtggcctcctccgaggacgtcatcaaagagttcatgcgcttcaaggtgcgcatggag
ggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgag
ggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggac
atcctgtccccccagttccagtacggctccaaggcgtacgtgaagcaccccgccgacatc
cccgactacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttc
gaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcacgctgatc
tacaaggtgaagttccgcggcaccaacttcccccccgacggccccgtaatgcagaagaag
accatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggc
gagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagacc
atctacatggccaagaagcccgtgcagctgcccggctactactacgtggacaccaagctg
gacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctccgagggc
cgccaccacctgttcctggggcatggcaccggcagcaccggcagcggcagctccggcacc
gcctcctccgaggacgtcatcaaagagttcatgcgcttcaaggtgcgcatggagggctcc
gtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacc
cagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggacatcctg
tccccccagttccagtacggctccaaggcgtacgtgaagcaccccgccgacatccccgac
tacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggac
ggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcacgctgatctacaag
gtgaagttccgcggcaccaacttcccccccgacggccccgtaatgcagaagaagaccatg
ggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgagatc
caccaggccctgaagctgaaggacggcggccactacctggtggagttcaagaccatctac
atggccaagaagcccgtgcagctgcccggctactactacgtggacaccaagctggacatc
acctcccacaacgaggactacaccatcgtggaacagtacgagcgctccgagggccgccac
cacctgttcctgtag
5' End
3' End
NotesThis is a tetrameric red fluorescent protein, so the length is doubled.
Expression VectorNApcDNA3
Assay MethodsNAFluorescence imaging
ResultsExpression not determinedWithin 12h cells displayed strong red fluorescence evenly distributed thoughout the nucleus and cytoplasm.
Protein FunctionReporter gene (Red fluorescent protein FP583)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usage optimized towards human codon preferences.
Publication Author(s)Campbell RE, Tour O, Palmer AE, Steinbach PA, Baird GS, Zacharias DA, Tsien RY.
Corresponding AuthorRoger Y. Tsien
Corresponding AddressDepartment of Pharmacology. University of California at San Diego, 9500 Gilman Drive, La Jolla, CA 92093, USA.
Publication Year2002
Publication TitleA monomeric red fluorescent protein.
AbstractAll coelenterate fluorescent proteins cloned to date display some form of quaternary structure, including the weak tendency of Aequorea green fluorescent protein (GFP) to dimerize, the obligate dimerization of Renilla GFP, and the obligate tetramerization of the red fluorescent protein from Discosoma (DsRed). Although the weak dimerization of Aequorea GFP has not impeded its acceptance as an indispensable tool of cell biology, the obligate tetramerization of DsRed has greatly hindered its use as a genetically encoded fusion tag. We present here the stepwise evolution of DsRed to a dimer and then either to a genetic fusion of two copies of the protein, i.e., a tandem dimer, or to a true monomer designated mRFP1 (monomeric red fluorescent protein). Each subunit interface was disrupted by insertion of arginines, which initially crippled the resulting protein, but red fluorescence could be rescued by random and directed mutagenesis totaling 17 substitutions in the dimer and 33 in mRFP1. Fusions of the gap junction protein connexin43 to mRFP1 formed fully functional junctions, whereas analogous fusions to the tetramer and dimer failed. Although mRFP1 has somewhat lower extinction coefficient, quantum yield, and photostability than DsRed, mRFP1 matures >10 times faster, so that it shows similar brightness in living cells. In addition, the excitation and emission peaks of mRFP1, 584 and 607 nm, are approximately 25 nm red-shifted from DsRed, which should confer greater tissue penetration and spectral separation from autofluorescence and other fluorescent proteins.
JournalProc Natl Acad Sci U S A.. 99(12): 7877-82.
SummaryThree versions of DsRed gene were designed with reference to the codon usage in human and expressed in human HeLa cells. All recoded genes showed strong red fluorescence in 12h.
CommentsThe study itself focused more on the activity of proteins coded by recoded genes.
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=500
PubMed ID12060735
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site