Synthetic Gene DataBase
 

Synthetic Gene 47


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID3947
GenBank AccessionAJ277646AY588147
GenBank GI993118446395049
Gene NameAMA1EcPfAMA1-FVO
Gene Length (bp)15661566
SpeciesPlasmodium falciparum (malaria)Cricetulus griseus
StrainsFVOCHO-K1
CDSatgataaactttggaagaggacagaattattgggaacatccatatcaaaaaagtgatgtg
tatcatccaatcaacgaacatagggaacatccaaaagaatacgaatatccattacaccag
gaacatacataccaacaagaagattcaggagaagacgaaaatacattacaacacgcatat
ccaatagaccacgaaggtgctgaacccgcaccacaagaacaaaatttattttcaagcatt
gaaatagtagaaagaagtaattatatgggtaatccatggacggaatatatggcaaaatat
gatattgaagaagttcatggttcaggtataagagtagatttaggagaagatgctgaagta
gctggaactcaatatagacttccatcagggaaatgtccagtatttggtaaaggtataatt
attgagaattcaaatactacttttttaaaaccggtagctacgggaaatcaagatttaaaa
gatggaggttttgcttttcctccaacaaatcctcttatatcaccaatgacattaaatggt
atgagagatttttataaaaataatgaatatgtaaaaaatttagatgaattgactttatgt
tcaagacatgcaggaaatatgaatccagataatgataaaaattcaaattataaatatcca
gctgtttatgattacaatgataaaaagtgtcatatattatatattgcagctcaagaaaat
aatggtcctagatattgtaataaagaccaaagtaaaagaaacagcatgttttgttttaga
ccagcaaaagataaattatttgaaaactatacatatttaagtaaaaatgtagttgataac
tgggaagaagtttgccctagaaagaatttagagaatgcaaaattcggattatgggtcgat
ggaaattgtgaagatataccacatgtaaatgaattttcagcaaatgatctttttgaatgt
aataaattagtttttgaattgagtgcttcggatcaacctaaacaatatgaacaacattta
acagattatgaaaaaattaaagaaggtttcaaaaataagaacgctagtatgatcaaaagt
gcttttcttcccactggtgcttttaaagcagatagatataaaagtcatggtaagggttat
aattggggaaattataacagagaaacacaaaaatgtgaaatttttaatgtcaaaccaaca
tgtttaattaacaattcatcatacattgctactactgctttgtcccatcccatcgaagtt
gaacacaattttccatgttcattatataaagatgaaataaagaaagaaatcgaaagagaa
tcaaaacgaattaaattaaatgataatgatgatgaagggaataaaaaaattatagctcca
agaatttttatttcagatgataaagacagtttaaaatgcccatgtgaccctgaaatggta
agtaatagtacatgtcgtttctttgtatgtaaatgtgtagaaagaagggcagaagtaaca
tcaaataatgaagttgtagttaaagaagaatataaagatgaatatgcagatattcctgaa
cataaaccaacttatgataacatgaaa
atgattaattttgggagagggcagaactactgggaacatccataccaaaagtctgatgtg
taccatccaataaatgaacatcgtgaacatccaaaggaatatgaatacccattgcaccag
gaacatacttatcaacaagaagattccggggaagacgaaaacactttgcaacacgcatac
ccaattgaccacgaaggagcggaacccgcaccacaagaacaaaacttgttttccagcatc
gaaattgtcgaaagatctaactacatgggaaacccatggacggaatacatggcaaagtac
gatatcgaagaagttcatggttccggaattagagtcgatttgggggaagatgcggaagtc
gcggggacacaatacagactaccatccggtaagtgtccagtctttggaaagggaattatc
atcgagaactccaagacaacatttttgactccggtcgcgacggggaaccaagatttgaag
gatggcggatttgcgtttcctccaactaaccctcttatttccccaatgactttgaacgga
atgagagatttttacaagaacaacgaatacgtcaagaacttggatgaactgacattgtgt
tccagacatgcagggaacatgaacccagataacgataagaactccaactacaagtaccca
gcggtttacgattataacgataagaaatgtcatattttgtacatcgcagcgcaagaaaac
aacggacctagatactgtaacaaggaccaatctaagagaaatagcatgttttgttttaga
ccagcaaaggataagttgtttgaaaatttggtctacttgtctaagaacgtcgttgataat
tgggaagaagtttgccctagaaagaacttggagaacgcaaagttcgggttgtgggtagat
gggaactgtgaagatattccacatgtcaacgaattttccgcaaacgatctttttgaatgt
aacaagttggtttttgaactgtctgcgtcggatcaacctaagcaatacgaacaacatttg
actgattacgaaaagatcaaggaaggattcaagaacaaaaatagagaaatgataaagtct
gcgtttcttcccacaggagcgtttaaggcagatagatacaagtctcatggaaaaggatac
aactgggggaactacaatagagaaactcaaaagtgtgaaatctttaacgtaaagccaact
tgtttgatcaatgacaagaactatatcgcgacaacagcgctgagtcatcccatagaagtt
gaacacaactttccatgttccttgtacaaggatgaaattaaaaaggaaatagaaagagaa
tccaagcgaatcaagttgaacgataacgatgatgaaggtaacaagaagatcattgcgcca
agaatctttatctccgatgataaggactctttgaagtgcccatgtgaccctgaaatggtc
tctaactctacttgtaggttctttgtctgtaagtgtgtcgaaagacgtgcagaagtcact
tccaacaacgaagttgtcgttaaggaagaatacaaggatgaatacgcagatatccctgaa
cataagccaacatacgataatatgaag
5' End
3' End
Notes
Expression VectorNAT8 (Mayer 2004)
Assay MethodsNAImmunofluorescence assay
ResultsNot determinedSuccessful expression in CHO cells
Protein FunctionHelp invasion (apical membrane antigen)
Recoding PurposeTo study the function
Synthesized ByGiersing et al. 2005
Recoding MethodThe method is described in Giersing et al. 2005
Publication Author(s)Kato K, Mayer DC, Singh S, Reid M, Miller LH.
Corresponding AuthorLouis Miller
Corresponding AddressLaboratory of Malaria and Vector Research and Malaria Vaccine Development Branch, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892-8132, USA.
Publication Year2005
Publication TitleDomain III of Plasmodium falciparum apical membrane antigen 1 binds to the erythrocyte membrane protein Kx.
AbstractPlasmodium falciparum apical membrane antigen 1 (AMA1) is located in the merozoite micronemes, an organelle that contains receptors for invasion, suggesting that AMA1 may play a role in this process. However, direct evidence that P. falciparum AMA1 binds to human erythrocytes is lacking. In this study, we determined that domain III of AMA1 binds to the erythrocyte membrane protein, Kx, and that the rate of invasion of Kx(null) erythrocytes is reduced, indicating a significant but not unique role of AMA1 and Kx in parasite invasion of erythrocytes. Domains I/II/III, domains I/II and domain III of AMA1 were expressed on the surface of CHO-K1 cells, and their ability to bind erythrocytes was determined. We observed that each of these domains failed to bind untreated human erythrocytes. In contrast, domain III, but not the other domains of AMA1, bound to trypsin-treated human erythrocytes. We tested the binding of AMA1 to trypsin-treated genetically mutant human erythrocytes, missing various erythrocyte membrane proteins. AMA1 failed to bind trypsin-treated Kx(null) (McLeod) erythrocytes, which lack the Kx protein. Furthermore, treatment of human erythrocytes with trypsin, followed by alpha-chymotrypsin, cleaved Kx and destroyed the binding of AMA1 to human erythrocytes. Lastly, the rate of invasion of Kx null erythrocytes by P. falciparum was significantly lower than Kx-expressing erythrocytes. Taken together, our data suggest that AMA1 plays an important, but not exclusive, role in invasion of human erythrocytes through a process that involves exposure or modification of the erythrocyte surface protein, Kx, by a trypsin-like enzyme.
JournalProc Natl Acad Sci U S A.. 102(15): 5552-7.
SummaryA version of synthetic AMA1 (codon optimized for expression in E. coli, Giersing et al. 2005) was expressed in Chinese hamster ovary (CHO) cells to study the function of various AMA1 domains. The expression was successful in CHO cells.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=504
PubMed ID15805191
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site