Synthetic Gene DataBase
 

Synthetic Gene 48


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID4048
GenBank AccessionAJ277646AY588147
GenBank GI993118446395049
Gene NameAMA1-FVOEcAMA1-FVO
Gene Length (bp)15661566
SpeciesPlasmodium falciparum (malaria)Escherichia coli
StrainsFVOBL21 (DE3)
CDSatgataaactttggaagaggacagaattattgggaacatccatatcaaaaaagtgatgtg
tatcatccaatcaacgaacatagggaacatccaaaagaatacgaatatccattacaccag
gaacatacataccaacaagaagattcaggagaagacgaaaatacattacaacacgcatat
ccaatagaccacgaaggtgctgaacccgcaccacaagaacaaaatttattttcaagcatt
gaaatagtagaaagaagtaattatatgggtaatccatggacggaatatatggcaaaatat
gatattgaagaagttcatggttcaggtataagagtagatttaggagaagatgctgaagta
gctggaactcaatatagacttccatcagggaaatgtccagtatttggtaaaggtataatt
attgagaattcaaatactacttttttaaaaccggtagctacgggaaatcaagatttaaaa
gatggaggttttgcttttcctccaacaaatcctcttatatcaccaatgacattaaatggt
atgagagatttttataaaaataatgaatatgtaaaaaatttagatgaattgactttatgt
tcaagacatgcaggaaatatgaatccagataatgataaaaattcaaattataaatatcca
gctgtttatgattacaatgataaaaagtgtcatatattatatattgcagctcaagaaaat
aatggtcctagatattgtaataaagaccaaagtaaaagaaacagcatgttttgttttaga
ccagcaaaagataaattatttgaaaactatacatatttaagtaaaaatgtagttgataac
tgggaagaagtttgccctagaaagaatttagagaatgcaaaattcggattatgggtcgat
ggaaattgtgaagatataccacatgtaaatgaattttcagcaaatgatctttttgaatgt
aataaattagtttttgaattgagtgcttcggatcaacctaaacaatatgaacaacattta
acagattatgaaaaaattaaagaaggtttcaaaaataagaacgctagtatgatcaaaagt
gcttttcttcccactggtgcttttaaagcagatagatataaaagtcatggtaagggttat
aattggggaaattataacagagaaacacaaaaatgtgaaatttttaatgtcaaaccaaca
tgtttaattaacaattcatcatacattgctactactgctttgtcccatcccatcgaagtt
gaacacaattttccatgttcattatataaagatgaaataaagaaagaaatcgaaagagaa
tcaaaacgaattaaattaaatgataatgatgatgaagggaataaaaaaattatagctcca
agaatttttatttcagatgataaagacagtttaaaatgcccatgtgaccctgaaatggta
agtaatagtacatgtcgtttctttgtatgtaaatgtgtagaaagaagggcagaagtaaca
tcaaataatgaagttgtagttaaagaagaatataaagatgaatatgcagatattcctgaa
cataaaccaacttatgataacatgaaa
atgattaattttgggagagggcagaactactgggaacatccataccaaaagtctgatgtg
taccatccaataaatgaacatcgtgaacatccaaaggaatatgaatacccattgcaccag
gaacatacttatcaacaagaagattccggggaagacgaaaacactttgcaacacgcatac
ccaattgaccacgaaggagcggaacccgcaccacaagaacaaaacttgttttccagcatc
gaaattgtcgaaagatctaactacatgggaaacccatggacggaatacatggcaaagtac
gatatcgaagaagttcatggttccggaattagagtcgatttgggggaagatgcggaagtc
gcggggacacaatacagactaccatccggtaagtgtccagtctttggaaagggaattatc
atcgagaactccaagacaacatttttgactccggtcgcgacggggaaccaagatttgaag
gatggcggatttgcgtttcctccaactaaccctcttatttccccaatgactttgaacgga
atgagagatttttacaagaacaacgaatacgtcaagaacttggatgaactgacattgtgt
tccagacatgcagggaacatgaacccagataacgataagaactccaactacaagtaccca
gcggtttacgattataacgataagaaatgtcatattttgtacatcgcagcgcaagaaaac
aacggacctagatactgtaacaaggaccaatctaagagaaatagcatgttttgttttaga
ccagcaaaggataagttgtttgaaaatttggtctacttgtctaagaacgtcgttgataat
tgggaagaagtttgccctagaaagaacttggagaacgcaaagttcgggttgtgggtagat
gggaactgtgaagatattccacatgtcaacgaattttccgcaaacgatctttttgaatgt
aacaagttggtttttgaactgtctgcgtcggatcaacctaagcaatacgaacaacatttg
actgattacgaaaagatcaaggaaggattcaagaacaaaaatagagaaatgataaagtct
gcgtttcttcccacaggagcgtttaaggcagatagatacaagtctcatggaaaaggatac
aactgggggaactacaatagagaaactcaaaagtgtgaaatctttaacgtaaagccaact
tgtttgatcaatgacaagaactatatcgcgacaacagcgctgagtcatcccatagaagtt
gaacacaactttccatgttccttgtacaaggatgaaattaaaaaggaaatagaaagagaa
tccaagcgaatcaagttgaacgataacgatgatgaaggtaacaagaagatcattgcgcca
agaatctttatctccgatgataaggactctttgaagtgcccatgtgaccctgaaatggtc
tctaactctacttgtaggttctttgtctgtaagtgtgtcgaaagacgtgcagaagtcact
tccaacaacgaagttgtcgttaaggaagaatacaaggatgaatacgcagatatccctgaa
cataagccaacatacgataatatgaag
5' End
3' End
Notes
Expression VectorNApET24d+
Assay MethodsNASDS-PAGE, Western blot, Coomassie blue staining
ResultsNot determinedSuccessful expression
Protein FunctionHelp invasion (apical membrane antigen)
Recoding PurposeTo improve expression
Synthesized ByAuthor
Recoding MethodThe coding sequences of the AMA1 gene was modified (N-linked glycosylation sites and codon bias for
GC-rich sequence) and optimized for expression in E. coli by normalizing its AT content according to
published values for E. coli and P. pastoris codon bias)
Publication Author(s)Giersing B, Miura K, Shimp R, Wang J, Zhou H, Orcutt A, Stowers A, Saul A, Miller LH, Long C, Singh S.
Corresponding AuthorSanjay Singh
Corresponding AddressMalaria Vaccine Development Branch, National Institute of Allergy and Infectious Diseases, Twinbrook I, Room 1210A, 5640 Fisher Lane, Rockville, Maryland 20852, USA.
Publication Year2005
Publication TitlePosttranslational modification of recombinant Plasmodium falciparum apical membrane antigen 1: impact on functional immune responses to a malaria vaccine candidate.
AbstractRecombinant apical membrane antigen 1 (AMA1) is a leading vaccine candidate for Plasmodium falciparum malaria, as antibodies against recombinant P. falciparum AMA1 (PfAMA1) interrupt merozoite invasion into erythrocytes. In order to investigate the role of posttranslational modification in modulating the functional immune response to recombinant AMA1, two separate alleles of PfAMA1 (FVO and 3D7), in which native N-glycosylation sites have been mutated, were produced using Escherichia coli and a Pichia pastoris expression system. Recombinant Pichia pastoris AMA1-FVO (PpAMA1-FVO) and PpAMA1-3D7 are O-linked glycosylated, and 45% of PpAMA1-3D7 is nicked, though all four recombinant molecules react with conformation-specific monoclonal antibodies. To address the immunological effect of O-linked glycosylation, we compared the immunogenicity of E. coli AMA1-FVO (EcAMA1-FVO) and PpAMA1-FVO antigens, since both molecules are intact. The effect of antigen nicking was then investigated by comparing the immunogenicity of EcAMA1-3D7 and PpAMA1-3D7. Our data demonstrate that there is no significant difference in the rabbit antibody titer elicited towards EcAMA1-FVO and PpAMA1-FVO or to EcAMA1-3D7 and PpAMA1-3D7. Furthermore, we have demonstrated that recombinant AMA1 (FVO or 3D7), whether expressed and refolded from E. coli or produced from the Pichia expression system, is equivalent and mimics the functionality of the native protein in in vitro growth inhibition assay experiments. We conclude that in the case of recombinant AMA1, the E. coli- and P. pastoris-derived antigens are immunologically and functionally equivalent and are unaffected by the posttranslational modification resulting from expression in these two systems.
JournalInfect Immun.. 73(7): 3963-70.
SummaryAMA1 genes from two P. falciparum strains were codon optimized for expression in E. coli and P. pastoris due to high AT content of the malaria genome. All four synthetic genes appeared to expressed at a detectable level.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=503
PubMed ID15972483
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site