Synthetic Gene DataBase
 

Synthetic Gene 5


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID55
GenBank AccessionM19921L21188
GenBank GI328415438609
Gene NameIntegraseIntegrase
Gene Length (bp)867867
Specieshuman immunodeficiency virus (HIV1)Escherichia coli
StrainsType 1DH5aF'Iq
CDSatgtttttagatggaatagataaggcccaagaagaacatgagaaatatcacagtaattgg
agagcaatggctagtgattttaacctaccacctgtagtagcaaaagaaatagtagccagc
tgtgataaatgtcagctaaaaggggaagccatgcatggacaagtagactgtagcccagga
atatggcagctagattgtacacatttagaaggaaaagttatcttggtagcagttcatgta
gccagtggatatatagaagcagaagtaattccagcagagacagggcaagaaacagcatac
ttcctcttaaaattagcaggaagatggccagtaaaaacagtacatacagacaatggcagc
aatttcaccagtactacagttaaggccgcctgttggtgggcggggatcaagcaggaattt
ggcattccctacaatccccaaagtcaaggagtaatagaatctatgaataaagaattaaag
aaaattataggacaggtaagagatcaggctgaacatcttaagacagcagtacaaatggca
gtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaaga
atagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaa
attcaaaattttcgggtttattacagggacagcagagatccagtttggaaaggaccagca
aagctcctctggaaaggtgaaggggcagtagtaatacaagataatagtgacataaaagta
gtgccaagaagaaaagcaaagatcatcagggattatggaaaacagatggcaggtgatgat
tgtgtggcaagtagacaggatgaggattaa
atgttcctggacggtatcgataaagctcaggaagaacacgaaaaataccactctaactgg
cgcgccatggcttctgacttcaacctgccgccggttgttgccaaggaaatcgtggcttct
tgcgacaaatgccaattgaaaggtgaagctatgcatggtcaggtcgactgctctccaggt
atctggcagctggactgcactcatctcgagggtaaagttatcctggttgctgttcacgtg
gcttccggatacatcgaagctgaagttatcccggctgaaaccggtcaggaaactgcttac
ttcctgcttaagctggccggccgttggccggttaaaactgttcacactgacaacggttct
aacttcactagtactactgttaaagctgcatgctggtgggccggcatcaaacaggagttc
gggatcccgtacaacccgcagtctcagggcgttatcgaatctatgaacaaagagctcaaa
aaaatcattggccaggtacgtgatcaggctgagcacctgaaaaccgcggtgcagatggct
gttttcatccacaacttcaaacgtaaaggtggtatcggtggttacagcgctggtgaacgt
atcgttgacatcatcgctactgatatccagactaaagaactgcagaaacagatcactaaa
atccagaacttccgtgtatactaccgtgactctagagacccggtttggaaaggtcctgct
aaactcctgtggaagggtgaaggtgctgttgttatccaggacaactctgacatcaaagtg
gtaccgcgtcgtaaagctaaaatcattcgcgactacggcaaacagatggctggtgacgac
tgcgttgctagccgtcaggacgaagactaaaagcttcaggc
5' Endgtccggaattcaggaggtaataatt
3' Endaagcttcaggc
Notes
Expression VectorpNL4-3pKK223-3
Assay MethodsSDS-PAGE/electrospray mass spectroscopy
ResultsSee Vincent er al. 1993>10 time increase compared with natural gene reported by Vincent et al. 1993
Protein FunctionEnzyme
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodA non-degenerate DNA sequence was reverse-translated (Fully optimized) according to Gouy and Gautier
1982, then compared with degenerate sequence without rare codons only to incorporate the restriction
sites
Publication Author(s)Holler, T. P.; Foltin, S. K.; Ye, Q. Z.; Hupe, D. J.
Corresponding Author
Corresponding AddressDepartment of Biochemistry, Parke-Davis Pharmaceutical Research, Division of Warner-Lambert Company, Ann Arbor, MI 48105.
Publication Year1993
Publication TitleHIV1 integrase expressed in Escherichia coli from a synthetic gene
AbstractHuman immunodeficiency virus type 1 (HIV1) integrase is cleaved from the gag-pol precursor by the HIV1 protease. The resulting 32-kDa protein is used by the infecting virus to insert a linear, double-stranded DNA copy of its genome, prepared by reverse transcription of viral RNA, into the host cell's chromosomal DNA. In order to achieve high levels of expression, to minimize an internal initiation problem and to facilitate mutagenesis, we have designed and synthesized a gene encoding the integrase from the infectious molecular clone, pNL4-3. Codon usage was optimized for expression in Escherichia coli and unique restriction sites were incorporated throughout the gene. A 905-bp cassette containing a ribosome-binding site, a start codon and the integrase-coding sequence, sandwiched between EcoRI and HindIII sites, was synthesized by overlap extension of nine long synthetic oligodeoxyribonucleotides [90-120 nucleotides (nt)] and subsequent amplification using two primers (28-30 nt). The cassette was subcloned into the vector pKK223-3 for expression under control of a tac promoter. The protein produced from this highly expressed gene has the expected N-terminal sequence and molecular mass, and displays the DNA processing, DNA joining and disintegration activities expected from recombinant integrase. These studies have demonstrated the utility of codon optimization, and lay the groundwork for structure-function studies of HIV1 integrase.
JournalGene. 136(2-Jan): 323-8.
SummaryExpression of a synthetic/optimized HIV1 integrase gene in E. coli increases more than ten folds compared with the wild type gene. A non-degenerate DNA sequence was reverse-translated (fully optimized) according to codon usage table compiled by Gouy and Gautier in 1982, and then compared with degenerate sequence without rare codons only to incorporate the restriction sites. Only the non-degenerate sequence was cloned into E. coli for the experiment; however, some degenerate codons are seen in the published sequence. The optimized gene was assembled from oligos using assembly PCR. Mutations that occurred during gene synthesis processes were corrected using mutagenesis. The final gene product was inserted into E. coli DH5¦ÁF'Iq using the pKK223-3-NY5IN-NdeI vector and induced with IPTG. The SDS-PAGE assay showed the 32 kDa integrase increaseed in concentration over a couple of hours. A consistently reappearing contaminant protein of 15 kDa was largely removed by heparin-Sepharose chromatography, leaving the HIV1 integrase at 85-90% purity. The overall production of the integrase as at least ten times greater than that resulting from the wild type gene. Comparison of integrase activity to an inactive integrase mutant D116N verified that the integrase was functional.
Commentsaa 472-476 changed from AGGAG to GGGCG to suppress internal initiation of Met 154
Discussion
PubMed ID7916726
Submitter NameZheng, Yuanpu
Submitter AddressUMBC
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site