Synthetic Gene DataBase
 

Synthetic Gene 50


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID4250
GenBank AccessionAY151052AY233272
GenBank GI3442167534421677
Gene NameaceGFP (acoeGFP )aceGFP
Gene Length (bp)717717
SpeciesAequorea coerulescens (belt jellyfish)Homo sapiens, Mus musculus, Aethiops sabeus
Strains293T cells, 3T3 murine cells, L929 murine cells, COS-1 cells
CDSatgagtaaaggagcagaacttttcactggagttgtcccaattcttattgaattaaatggt
gatgttaatgggcacaaattctctgtcagtggagagggcgaaggtgatgcgacatacgga
aagttaacccttaaatttatttgcactacaggaaaactacctgttccatggccaacactt
gtcactactttctcttatggtgttcaatgcttttcaagatatccagatcatatgaaacag
catgacttcttcaagagtgccatgcctgaaggttatatacaggaaagaactatatttttc
aaagatgacgggaactacaagtcgcgtgctgaagtcaagttcgaaggtgataccctggtt
aatagaattgagttaacaggtactgattttaaagaagatggaaacatccttggaaataaa
atggaatacaactataacgcacataatgtatacatcatgacagacaaagcaaaaaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaacttgcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagataaccattac
ctgtccacacaatctaccctttccaaagatcccaacgaaaagagagatcacatgatctat
tttgagtttgtaacagctgctgcgattacacatggcatggatgaattatacaaataa
atgagcaagggcgccgagctgttcaccggcatcgtgcccatcctgatcgagctgaatggc
gatgtgaatggccacaagttcagcgtgagcggcgagggcgagggcgatgccacctacggc
aagctgaccctgaagttcatctgcaccaccggcaagctgcctgtgccctggcccaccctg
gtgaccaccctgagctacggcgtgcagtgcttctcacgctaccccgatcacatgaagcag
cacgacttcttcaagagcgccatgcctgagggctacatccaggagcgcaccatcttcttc
gaggatgacggcaactacaagtcgcgcgccgaggtgaagttcgagggcgataccctggtg
aatcgcatcgagctgaccggcaccgatttcaaggaggatggcaacatcctgggcaataag
atggagtacaactacaacgcccacaatgtgtacatcatgaccgacaaggccaagaatggc
atcaaggtgaacttcaagatccgccacaacatcgaggatggcagcgtgcagctggccgac
cactaccagcagaatacccccatcggcgatggccctgtgctgctgcccgataaccactac
ctgtccacccagagcgccctgtccaaggaccccaacgagaagcgcgatcacatgatctac
ttcggcttcgtgaccgccgccgccatcacccacggcatggatgagctgtacaagtga
5' End
3' End
Notes
Expression VectorpEGFP-C1 and pEGFP-ActinpEGFP-C1 and pEGFP-Actin
Assay MethodsFluorescence imagingFluorescence imaging
Resultsvery low fluorecent signals in mammalian cell linesSignificant brighter fluorecent signals without aggregation in mammalian cell lines .
Protein FunctionReporter gene (GFP-like protein)
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usage was optimized according to mammalian codon preference (no references).
Publication Author(s)Gurskaya, NG; Fradkov AF; Pounkova NI; Staroverov DB; Bulina ME; Yanushevich YG; Labas YA; Lukyanov S; Lukyanov KA.
Corresponding AuthorKonstantin A. Lukyanov
Corresponding AddressShemyakin and Ovchinnikov Institute of Bioorganic Chemistry RAS, Miklukho-Maklaya 16/10, Moscow 117997, Russia.
Publication Year2003
Publication TitleA colourless green fluorescent protein homologue from the non-fluorescent hydromedusa Aequorea coerulescens and its fluorescent mutants.
AbstractWe have cloned an unusual colourless green fluorescent protein (GFP)-like protein from Aequorea coerulescens (acGFPL). The A. coerulescens specimens displayed blue (not green) luminescence, and no fluorescence was detected in these medusae. Escherichia coli expressing wild-type acGFPL showed neither fluorescence nor visible coloration. Random mutagenesis generated green fluorescent mutants of acGFPL, with the strongest emitters found to contain an Glu(222)-->Gly (E222G) substitution, which removed the evolutionarily invariant Glu(222). Re-introduction of Glu(222) into the most fluorescent random mutant, named aceGFP, converted it into a colourless protein. This colourless aceGFP-G222E protein demonstrated a novel type of UV-induced photoconversion, from an immature non-fluorescent form into a green fluorescent form. Fluorescent aceGFP may be a useful biological tool, as it was able to be expressed in a number of mammalian cell lines. Furthermore, expression of a fusion protein of 'humanized' aceGFP and beta-actin produced a fluorescent pattern consistent with actin distribution in mammalian cells.
JournalBiochem J.. 373(2): 403-8.
SummaryThe natural aceGFP produced very low fluorescent signal in human cell lines, suggesting non-optimal codon usage. To overcome this possible problem, the codon usage was optimized towards mammalian codon preference. As a result, bright green signals were produced in various cell lines.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=492
PubMed ID12693991
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site