Synthetic Gene DataBase
 

Synthetic Gene 51


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID4351
GenBank AccessionBC073771AY191459
GenBank GI4925746327922830
Gene NamelscHSV8-lsc
Gene Length (bp)18931893
SpeciesHomo sapiensChlamydomonas reinhardtii, Escherichia coli
Strainschloroplast
CDSatggagtttgggctgagctgggttttccttgttgctattttaaaaggtgtccagtgtgag
gtgcagctggtggagtccgggggaggcttagttcagccgggggggtccctgagactctcc
tgtgcagcctctggattcatcttcagtagttactggatgcactgggtccgccaagctcca
gggaaggggctggtgtgggtctcacgaattaatagtgatgggagtagcacaagttacgcg
gactccgtgaagggccgattcaccatctccagagacaacgccaagaatacgctgtatctg
caaatgaacagtctgagaggcgaggacgcggctgtatattactgtgcgagaggatttgtt
agtctacctcgaagtactcttgatatttggggccaagggacaatggtcaccgtctcttca
gcatccccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccagatggg
aacgtggtcatcgcctgcctggtccagggcttcttcccccaggagccactcagtgtgacc
tggagcgaaagcggacagggcgtgaccgccagaaacttcccacccagccaggatgcctcc
ggggacctgtacaccacgagcagccagctgaccctgccggccacacagtgcctagccggc
aagtccgtgacatgccacgtgaagcactacacgaatcccagccaggatgtgactgtgccc
tgcccagttccctcaactccacctaccccatctccctcaactccacctaccccatctccc
tcatgctgccacccccgactgtcactgcaccgaccggccctcgaggacctgctcttaggt
tcagaagcgaacctcacgtgcacactgaccggcctgagagatgcctcaggtgtcaccttc
acctggacgccctcaagtgggaagagcgctgttcaaggaccacctgagcgtgacctctgt
ggctgctacagcgtgtccagtgtcctgccgggctgtgccgagccatggaaccatgggaag
accttcacttgcactgctgcctaccccgagtccaagaccccgctaaccgccaccctctca
aaatccggaaacacattccggcccgaggtccacctgctgccgccgccgtcggaggagctg
gccctgaacgagctggtgacgctgacgtgcctggcacgtggcttcagccccaaggatgtg
ctggttcgctggctgcaggggtcacaggagctgccccgcgagaagtacctgacttgggca
tcccggcaggagcccagccagggcaccaccaccttcgctgtgaccagcatactgcgcgtg
gcagccgaggactggaagaagggggacaccttctcctgcatggtgggccacgaggccctg
ccgctggccttcacacagaagaccatcgaccgcttggcgggtaaacccacccatgtcaat
gtgtctgttgtcatggcggaggtggacggcacctgctactga
atggttgctcaagctgcttcatcagaattaacgcaatcaccaggtaccttatcattatca
ccaggtgaacgtgctaccttatcatgtcgtgcttcacaatcagtttcatcagcttactta
gcttggtaccaacaaaaaccaggtcaagctccacgtttattaatttacggtgcttcatca
cgtgctactggtattccagatcgtttctcaggttcaggttcaggtacagatttcacttta
accatttcacgtttagaaccagaagatttcgctgtttactactgtcaacaatacggtcgt
tcaccaactttcggtggtggtaccaaagttgaaattaaacgtacttcatcaggtggtggt
ggttcaggtggtggtggtggtggttcatcacgttcatcattagaacaatcaggtgctgaa
gttaaaaaaccaggttcatcagttaaagtttcatgtaaagcttcaggtggttcattctca
tcatacgctattaactgggttcgtcaagctcaaggtcaaggtttagaatggatgggtggt
ttaatgccaattttcggtacaacaaactacgctcaaaaattccaagatcgtttaacgatt
accgctgatgtttcaacgtcaacagcttacatgcaattatcaggtttaacatacgaagat
acggctatgtactactgtgctcgtgttgcttacatgttagaaccaaccgttactgctggt
ggtttagatgtttggggtaaaggtaccacggttaccgtttcaccagcttcaccaacctca
ccaaaagttttcccattatcattatgttcaacccaaccagatggtaacgttgttattgct
tgtttagttcaaggtttcttcccacaagaaccattatcagttacctggtcagaatcaggt
caaggtgttaccgctcgtaacttcccaccatcacaagatgcttcaggtgatttatacacc
acgtcatcacaattaaccttaccagctacacaatgtttagctggtaaatcagttacatgt
cacgttaaacactacacgaacccatcacaagatgttactgttccatgtccagttccatca
actccaccaaccccatcaccatcaactccaccaaccccatcaccatcatgttgtcaccca
cgtttatcattacaccgtccagctttagaagatttattattaggttcagaagctaactta
acgtgtacattaaccggtttacgtgatgcttcaggtgttaccttcacctggacgccatca
tcaggtaaatcagctgttcaaggtccaccagaacgtgatttatgtggttgttactcagtt
tcatcagttttaccaggttgtgctgaaccatggaaccacggtaaaaccttcacttgtact
gctgcttacccagaatcaaaaaccccattaaccgctaccttatcaaaatcaggtaacaca
ttccgtccagaagttcacttattaccaccaccatcagaagaattagctttaaacgaatta
gttacgttaacgtgtttagctcgtggtttctcaccaaaagatgttttagttcgttggtta
caaggttcacaagaattaccacgtgaaaaatacttaacttgggcttcacgtcaagaacca
tcacaaggtaccaccaccttcgctgttacctcaattttacgtgttgctgctgaagattgg
aaaaaaggtgataccttctcatgtatggttggtcacgaagctttaccattagctttcaca
caaaaaaccattgatcgtttagctggtaaaccaacccacgttaacgtttcagttgttatg
gctgaagttgatggtacctgttacgattataaagatcacgatggtgattacaaagatcac
gatattgattataaagatgatgatgataaataa
5' End
3' End
NotesThere is no wild-type gene reported in the paper. Therefore, the most similar one in the GenBank (BC073771, found by Blastn) was included for reference.
Expression VectorNApET
Assay MethodsNAWestern blot
ResultsNot reportedSignificant accumulation of HSV8-lsc protein was observed in E. coli and trangenic C. reinhardtii but not in wild-type (non-transgenic) algae.
Protein FunctionAntibody (large single chain)
Recoding PurposeTo improve expression
Synthesized ByAuthor
Recoding MethodCodon usage was optimized according to codon preferences in abundantly expressed Chlamydomonas
reinhardtii chloroplast genes
Publication Author(s)Mayfield SP, Franklin SE, Lerner RA.
Corresponding AuthorScott E. Franklin
Corresponding AddressDepartments of Cell Biology and Chemistry, Skaggs Institute for Chemical Biology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037, USA.
Publication Year2003
Publication TitleExpression and assembly of a fully active antibody in algae.
AbstractAlthough combinatorial antibody libraries have solved the problem of access to large immunological repertoires, efficient production of these complex molecules remains a problem. Here we demonstrate the efficient expression of a unique large single-chain (lsc) antibody in the chloroplast of the unicellular, green alga, Chlamydomonas reinhardtii. We achieved high levels of protein accumulation by synthesizing the lsc gene in chloroplast codon bias and by driving expression of the chimeric gene using either of two C. reinhardtii chloroplast promoters and 5' and 3' RNA elements. This lsc antibody, directed against glycoprotein D of the herpes simplex virus, is produced in a soluble form by the alga and assembles into higher order complexes in vivo. Aside from dimerization by disulfide bond formation, the antibody undergoes no detectable posttranslational modification. We further demonstrate that accumulation of the antibody can be modulated by the specific growth regime used to culture the alga, and by the choice of 5' and 3' elements used to drive expression of the antibody gene. These results demonstrate the utility of alga as an expression platform for recombinant proteins, and describe a new type of single chain antibody containing the entire heavy chain protein, including the Fc domain.
JournalProc Natl Acad Sci U S A.. 100(2): 438-42.
SummaryA human antibody gene (large single chain) was recoded for expression in Chlamydomonas reinhardtii chroloplast to show the potential of using this alga as a system for production of antibodies. Codon optimization was done according to native abundantly expressed genes. The codon optimized HSV8-lsc gene showed significant accumulation in E. coli and trangenic algae.
CommentsNo wild type lsc gene reported in the paper
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=508
PubMed ID12522151
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site