Synthetic Gene DataBase
 

Synthetic Gene 52


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID4452
GenBank Accession
GenBank GI
Gene Namewtgagsyngag
Gene Length (bp)15391539
Specieshuman immunodeficiency virus (HIV1)Homo sapiens
StrainsType 1H1299
CDSatgggcgccagggccagcgtgctgagcggcggcgagctggacaggtgggagaagatcagg
ctgaggcccggcggcaagaagaagtataagctgaagcacatcgtgtgggccagcagggag
ctggagaggttcgccgtgaaccccggcctgctggagaccagcgagggctgcaggcagatc
ctgggccagctgcagcccagcctgcagaccggcagcgaggagctgaggagcctgtacaac
accgtggccaccctgtactgcgtgcaccagaggatcgagatcaaggacaccaaggaggcc
ctggacaagatcgaggaggagcagaacaagtccaagaagaaggcccagcaggccgccgcc
gacaccggccacagcagccaggtgagccagaactaccccatcgtgcagaacatccagggc
cagatggtgcaccaggccatcagccccaggaccctgaacgcctgggtgaaggtggtggag
gagaaggccttcagccccgaggtgatccccatgttcagcgccctgagcgagggagccacc
ccccaggacctgaacaccatgctgaacaccgtgggcggccaccaggccgccatgcagatg
ctgaaggagaccatcaacgaggaggccgccgagtgggacagggtgcaccccgtgcacgcc
ggccccatcgcccccggccagatgagggagccccgcggcagcgacatcgccggcaccacc
agcaccctgcaggagcagatcggctggatgaccaacaacccccccatccccgtgggcgaa
atctacaagaggtggatcatcctgggcctgaacaagatcgtgaggatgtacagccccacc
agcatcctggatatcaggcagggccccaaagagcccttcagggactacgtggacaggttc
tacaagaccctgcgcgccgagcaggccagccaggaggtgaagaactggatgaccgagacc
ctgctggtgcagaacgccaaccccgactgcaagaccatcctgaaggccctgggacccgcc
gccaccctggaggagatgatgaccgcctgccagggcgtgggcggccccggccacaaggcc
agggtgctggccgaggccatgagccaggtgaccaacaccgccaccatcatgatgcagagg
ggcaacttcaggaaccagaggaagatggtgaagtgcttcaactgcggcaaggagggccac
accgccaggaactgccgcgcccccaggaagaagggctgctggaagtgcggcaaggagggc
caccagatgaaggactgcaccgagaggcaggccaacttcctgggcaagatctggcccagc
tacaagggcaggcccggcaacttcctgcagagcaggcccgagcccaccgccccccccttc
ctgcagagcaggcccgagcccaccgccccccccgaggagagcttcaggagcggcgtggag
accaccacccccccccagaagcaggagcccatcgacaaggagctgtaccccctgaccagc
ctgaggagcctgttcggcaacgacccctcgtcacaataa
atgggtgcgagagcgtcagtattaagcgggggagaattagatcgatgggaaaaaattcgg
ttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggag
ctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaata
ctgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataat
acagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagct
ttagacaagatagaggaagagcaaaacaaaagtaagaaaaaagcacagcaagcagcagct
gacacaggacacagcagtcaggtcagccaaaattaccctatagtgcagaacatccagggg
caaatggtacatcaggccatatcacctagaactttaaatgcatgggtaaaagtagtagaa
gagaaggctttcagcccagaagtaatacccatgttttcagcattatcagaaggagccacc
ccacaagatttaaacaccatgctaaacacagtggggggacatcaagcagccatgcaaatg
ttaaaagagaccatcaatgaggaagctgcagaatgggatagagtacatccagtgcatgca
gggcctattgcaccaggccagatgagagaaccaaggggaagtgacatagcaggaactact
agtacccttcaggaacaaataggatggatgacaaataatccacctatcccagtaggacaa
atttataaaagatggataatcctgggattaaataaaatagtaagaatgtatagccctacc
agcattctggacataagacaaggaccaaaagaaccttttagagactatgtagaccggttc
tataaaactctaagagccgagcaagcttcacaggaggtaaaaaattggatgacagaaacc
ttgttggtccaaaatgcgaacccagattgtaagactattttaaaagcattgggaccagcg
gctacactagaagaaatgatgacagcatgtcagggagtaggaggacccggccataaggca
agagttttggctgaagcaatgagccaagtaacaaatacagctaccataatgatgcagaga
ggcaattttaggaaccaaagaaagatggttaagtgtttcaattgtggcaaagaagggcac
acagccagaaattgcagggcccctaggaaaaagggctgttggaaatgtggaaaggaagga
caccaaatgaaagattgtactgagagacaggctaattttttagggaagatctggccttcc
tacaagggaaggccagggaattttcttcagagcagaccagagccaacagccccaccattt
cttcagagcagaccagagccaacagccccaccagaagagagcttcaggtctggggtagag
acaacaactccccctcagaagcaggagccgatagacaaggaactgtatcctttaacttcc
ctcagatcactctttggcaacgaccccagcagccagtga
5' End
3' End
NotesThe wt type gene sequence from the article is different from the sequence from the NCBI gene bank (Acession number: NC_001802). The sequences used in this record are the same as the sequences from the article.
Expression VectorNANA
Assay MethodsELISA,Western blotting, Northern blottingELISA, Western blotting, Northern blotting
ResultsUndetectable.Significant increase.
Protein FunctionDNA binding ( GO:0003677 ), RNA binding ( GO: 0003723), RNA-directed DNA polymerase activity ( GO: 0003964)
Recoding PurposeTo improve expression
Synthesized ByAuthors ( PCR amplification)
Recoding MethodThe synthetic gag gene was introduced by more than 400 substitutions homogeneously distributed
throughout the complete gag gene, thereby reducing the AT content of the wild-type gag gene from
55.9% down to only 33.9%. Almost every wobble position within the wild-type coding region was
changed to a G or C, resulting in a diverse nucleotide composition and decreased AT content without
alterations within the encoded protein. The synthetic gag gene was constructed by a stepwise PCR
amplification of overlapping 60-nucleotide (nt)-long oligonucleotides, encoding the entire Pr55gag
polyprotein.
Publication Author(s)Graf, M.; Bojak, A.; Deml, L.; Bieler, K.; Wolf, H.; Wagner, R.
Corresponding AuthorRalf Wagner
Corresponding AddressInstitute of Medical Microbiology and Hygiene, University of Regensburg, D-93053 Regensburg, Germany.
Publication Year2000
Publication TitleConcerted action of multiple cis-acting sequences is required for Rev dependence of late human immunodeficiency virus type 1 gene expression
AbstractBased on the human immunodeficiency virus type 1 (HIV-1) gag gene, subgenomic reporter constructs have been established allowing the contributions of different cis-acting elements to the Rev dependency of late HIV-1 gene products to be determined. Modification of intragenic regulatory elements achieved by adapting the codon usage of the complete gene to highly expressed mammalian genes resulted in constitutive nuclear export allowing high levels of Gag expression independent from the Rev/Rev-responsive element system and irrespective of the absence or presence of the isolated major splice donor. Leptomycin B inhibitor studies revealed that the RNAs derived from the codon-optimized gag gene lacking AU-rich inhibitory elements are directed to a distinct, CRM1-independent, nuclear export pathway.
JournalJ Virol. 74(22): 10822-6.
SummaryThe purpose is to determine the contribution of the proposed cis-active inhibitory sequences (INS) within the gag coding region and the 5’ untranslated region (UTR) including the major splice donor(SD) on Rev/RRE, nuclear RNA stability, and the export of the HIV-1 Gag-encoding transcripts. For this purpose, a codon-optimized gag gene (syngag), in which AT content of the wtgag gene is reduced from 55.9% down to only 33.9%, is designed by employing a codon usage occurring most frequently in highly expressed mammalian genes. The experiments were done and the results show that the expressing of syngag is independent of the Rev/Rev-responsive element system and irrespective of the absence or present of the isolated major splice donor, and the RNA derived from that gene are directed to a distinct, CRM1-independent, nuclear export pathway. Finally, a conclusion, which is consistent with the expectation, is made that the overall AU rich content of the gag RNA, rather than previously proposed INS elements, contributes to stability and nuclear retention of the wtgag RNA.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=666
PubMed ID11044131
Submitter NameZin, Htar
Submitter Address1000 Hilltop Circle, Baltimore, MD 21250
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site