Synthetic Gene DataBase
 

Synthetic Gene 53


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID4553
GenBank AccessionAY860110AY860111
GenBank GI6110646761106481
Gene Nameint (integrase)int-OPT
Gene Length (bp)11341543
SpeciesMicromonospora rosariaActinomycete
StrainsSCC2095G+C rich
CDSatgggtagtcgccgccagttcggttcggttcgcaagctgccgtcggggcgttttcaggcg
tcgttccttccgcctggtggtgggcctcgacagaacgcgccacacacgttcaagacgaag
actgatgctcatcggtggctcacccgcgttgaggccgacatctcgcggggtacctggttg
gatgaccgggcggccggtgagaccttcggtaactacgcacgggccatcctgcgggacagc
ccgaagatcggtgtccgctggcgggagacctgcgaacggaacttgaggcttcacctggtg
ccgctggtcacggtgcccctgcgggaggtgacggccagccgggtccgcgaatggcacgct
gctgccctacggggctccggtggccgcacatccatctctcagtcgtaccggttcctgcgg
atggtcatgaacaccgctgtccgtgagggcatcatcgcccggtcaccctgccagatcccc
ggagcgggcaccgtccgtgctgcggaacggccggttgccaccccggctcaggtcgtcgcc
ctggtcgaggccatcaacccgcgctaccggacggcggtcctgatcgcggcctggtgcggc
ctacgccggggagagatcgcaggactccgggtcgcagacgtggacctgaccgaacacacc
atcaccgtccgcaaagccagggtcgaaccgctgcacgacagggggaaggcgtttgacaag
gatcccaagtccgaggcgggcaagcgaaccatcgccatccctccccacgtcgtacccgtg
atccgcctgcacctcgacgagttcgccgggaaggatcgcctgttcgtcagccgcgacgga
tcacccctgcgcggcgacaccctgtaccaggcgttcgtacgcgctcggggaaaggtcgga
ctcgacaccctcaccttccacgacctgcggcacaccggtcagaccctcgccgcgcagacc
ggggcgaccttggccgacctgatgaagcggctcgggcactcgtccatggctgcggctcgc
cggtacctccacgccgttgacggtcgtgaccgggagatcgccaaagccctttccgagctg
gcggcgcacggtgatgtcgcacggctgccccggcacatcacgatgcggagttag
atggtcgggcgcgagggcgggggcctcatggggagccggcggcagttcggctccgtccgg
aagctcccctcgggccgcttccaggcgtcgttcctgccgccggggggcgggccgcgccag
aacgcgccccacacgttcaagacgaagaccgacgcgcaccgctggctgacccgggtcgag
gcggacatctcccggggcacctggctcgacgaccgcgccgccggggagaccttcggcaac
tacgcccgcgccatcctgcgggactcgccgaagatcggggtccgctggcgggagacctgc
gagcggaacctgcggctgcacctcgtgccgctcgtgaccgtgccgctgcgcgaggtcacc
gcgtcccgcgtccgcgagtggcacgcggccgcgctgcggggctcgggcggccggacgtcg
atctcccagagctaccgcttcctccgcatggtcatgaacaccgcggtccgcgagggcatc
atcgcccggtcgccgtgccagatcccgggcgcgggcaccgtccgcgcggcggagcgcccc
gtggcgaccccggcccaggtcgtcgccctcgtggaggccatcaacccccgctaccggacc
gccgtgctgatcgccgcctggtgcggcctgcggcgcggcgagatcgccggcctgcgggtg
gcggacgtggacctcaccgagcacacgatcaccgtgcgcaaggcccgggtggagccgctg
cacgaccggggcaaggcgttcgacaaggaccccaagtccgaggccggcaagcggaccatc
gccatccccccccacgtcgtcccggtgatccggctgcacctcgacgagttcgccggcaag
gaccgcctgttcgtgtcgcgggacggctcgccgctccggggcgacacgctgtaccaggcg
ttcgtccgcgcccggggcaaggtcggcctggacaccctcacgttccacgacctgcggcac
accgggcagaccctcgccgcgcagaccggcgccaccctcgccgacctgatgaagcgcctc
ggccacagctcgatggcggcggcgcggcgctacctgcacgccgtggacggccgcgaccgg
gagatcgccaaggccctctcggagctggccgcgcacggcgacgtggcccgcctcccccgc
cacatcaccatgcgctcctga
5' Endgggacgcggtcgatcttgacggctggcgagaggtgcggggaggatctgacagatctgctc
gctcgcgggaggaccattgtc
3' Endtcgcacagacgttgcacgacgggcaccggcaagcccctgacctgggaaaatgttggtgcc
tgaaaatcggaaggtcggcggttcgaccccgcccctggccacatagcctttcgccgggct
accaaggtccccaccagcggaaacgccggtggggatcttcttgtatgccctcttggcgca
tcgatcggcgttgcccgtggttggccgtccttgaccgctcattgccgccggctatcgcac
gtagatcgcacgccctccccctctgctgaaacgcgcgagacgaaaggattaatttggatc
c
Notes
Expression VectorNANA
Assay MethodsNANA
ResultsExpression not determinedNo expression data was given. Instead, it was shown that int-OPT was functional for site-specific integration.
Protein Functionsite-specific recombinases, DNA breaking-rejoining enzymes
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon optimized to reflect high GC actinomycete codon preference (Wright and Bibb 1992).
Publication Author(s)Hosted TJ Jr, Wang T, Horan AC.
Corresponding AuthorThomas J. Hosted
Corresponding AddressNew Lead Discovery, Schering Plough Research Institute, 2015 Galloping Hill Road, K15-C321-MS3600, Kenilworth, NJ 07033, USA
Publication Year2005
Publication TitleCharacterization of the Micromonospora rosaria pMR2 plasmid and development of a high G+C codon optimized integrase for site-specific integration.
AbstractpMR2, an 11.1 kb plasmid was isolated from Micromonospora rosaria SCC2095, NRRL3718, and its complete nucleotide sequence determined. Analysis revealed 13 ORFs including homologs of a KorSA regulatory protein and TraB plasmid transfer protein found on other actinomycete plasmids. pMR2 contains att/int functions consisting of an integrase, an excisionase, and a putative plasmid attachment site (attP). The integrase gene contained a high frequency of codons rarely used in high G+C actinomycete coding regions. The gene was codon optimized for actinomycete codon usage to create the synthetic gene int-OPT. pSPRX740, containing an rpsL promoter and the att/int-OPT region, was introduced into Micromonospora halophytica var. nigra ATCC33088. Analysis of DNA flanking the pSPRX740 integration site confirmed site-specific integration into a tRNA(Phe) gene in the M. halopytica var. nigra chromosome. The pMR2 attP element and chromosomal attachment (attB) site contain a 63 bp region of sequence identity overlapping the 3' end of the tRNA(Phe) gene. Plasmids comprising the site-specific att/int-OPT functions of pMR2 can be used to integrate genes into the chromosome of actinomycetes with an appropriate tRNA gene. The development of an integrative system for Micromonospora will expand our ability to study antibiotic biosynthesis in this important actinomycete genus.
JournalPlasmid.. 54(3): 249-58.
SummaryWright and Bibb (1992) reported a general GC3 of 90% in actinomycetes. Micromonospora rosaria wild-type integrase sequence contains a low GC (80.1%) compared with a normal gene rep (87%). Therefore, a codon optimization approach was employed to improve the function of integrase. Although it appeared that the codon optimized form integrase worked well,there was no comparison between the activity of the natural and modified versions of integrase gene.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=523
PubMed ID16024079
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site