Synthetic Gene DataBase
 

Synthetic Gene 54


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID4654
GenBank AccessionAF260931AY803761
GenBank GI1024222155274785
Gene NameVP6sVP6
Gene Length (bp)11941194
SpeciesHomo sapiensNicotiana tabacum
StrainspGEM-VP6pBsVP6
CDSatggaggttctgtactcattgtcaaaaactcttaaagatgctagagataaaattgttgaa
ggtacattatattccaatgttagcgatctcattcaacaatttaatcaaatgataatgact
atgaatggaaatgactttcaaactggaggaattggtaatttaccagttagaaattggatt
tttgattttggtctattaggtacaacacttttaaatttggatgctaattatgttgaaaat
gcaagaactacgattgaatatttcattgattttattgataatgtatgtatggatgaaatg
gcaagagagtctcaaagaaatggagtagctccacaatctgaagcgttgaggaaattatca
ggcattaaatttaagaggataaattttgataattcatcagaatatatagaaaattggaat
ctacaaaatagaagacagcgtactggatttgtctttcataaacctaatatatttccatac
tcagcttcgttcactttgaatagatctcaaccaatgcatgataatttgatgggaactatg
tggcttaatgctggatcggagatacaagtagctggttttgattattcatgtgctataaac
gcaccagcaaatatacagcagtttgaacatattgtacagcttagacgtgcactaaccaca
gctactataactttgttacctgatgcagaaagatttagttttccaagagttatcaattcg
gctgacggcgcaactacatggttttttaatccagtcattctaagaccaaataatgtagaa
gtagaatttttgttgaatggacaaattattaacacatatcaggctagatttggtactatt
atcgcaggaaattttgatacaattcgattgtcatttcagttaatgcgtccaccaaatatg
acaccagctgttaacgcattatttccgcaagcgcaaccttttcaacaccatgcaacagtt
ggactcacattacgcattgaatctgctgtctgtgaatcagtgcttgcggatgcgaatgaa
actctgttagcgaatgtgaccgcagtgcgtcaagaatatgctataccagttggaccggtt
tttccaccaggcatgaattggactgagctaattactaactattcaccatcgagagaagat
aacctgcaacgtgtctttacagtagcttccattagaagcatgttgattaagtga
atggaggttctgtactcattgtctaagactcttaaagatgctagagacaagattgttgaa
ggcacactctattccaatgttagcgatctcattcagcaattcaatcaaatgatcatgact
atgaatggaaatgacttccaaactggaggcattggtaaccttccagttaggaattggatc
tttgattttggtcttttgggtacaacccttcttaacttggatgctaactatgttgaaaat
gccagaactaccattgagtacttcattgactttattgacaatgtctgcatggatgaaatg
gcaagagagtctcaaagaaatggagtggctcctcaatctgaggccttgaggaaactctca
gggatcaaattcaagaggatcaactttgataactcctcagaatacatagaaaactggaat
ctccaaaacagacgccagcgtactggatttgtcttccataagcctaacatatttccctac
tcagccagcttcaccttgaatagatctcagcccatgcatgataacttgatgggaactatg
tggcttaatgctggaagtgagatccaagtggctggttttgactattcctgtgctataaac
gcaccagccaacatacagcagtttgagcacattgtccagcttagacgtgcactcaccaca
gctactatcaccttgcttcctgatgcagaaagattcagtttcccaagggttatcaacagt
gctgacggggcaactacctggttctttaatcctgtcattcttaggccaaacaatgtggag
gtggagttcttgttgaatggacagattatcaacacataccaggctcgctttggtaccatt
atcgcaggaaactttgatacaattcgattgagcttccagttgatgcgtccacccaacatg
acaccagctgttaacgcactcttcccacaagcccaacctttccaacaccatgccacagtt
ggactcaccttgcgcattgaatctgctgtctgcgaatcagtgcttgccgatgccaatgag
actctgcttgccaatgtgaccgcagtgcgtcaagaatatgctataccagttggtcctgtt
ttcccacctggcatgaactggactgagcttatcactaactactctccatccagggaagac
aacctgcaacgtgtctttacagtggcttccattagaagcatgttgatcaagtaa
5' Endaaccaacc
3' End
Notes
Expression VectorpBI121pBI121
Assay MethodsWestern blot, Southern blot, SDS-PAGE, sandwich ELISAWestern blot, Southern blot, SDS-PAGE, sandwich ELISA
ResultsVery little significant increase (After transforming tobacco plants with VP6 ranged from 0.01%-0.05% TSP.)Significant increase (0.19%-0.34%, 3.8-34 times higher than unmodified tobacco plants)
Protein Functionof protein capsid which encases human rotavirus group A
Recoding PurposeTo improve expression
Synthesized ByShangai Sangon Company
Recoding MethodUsing codon optimization. For expression in plants, the VP6 gene was modified for plants so four
ATTA sequences were modified as well as six potential polyadenylylation signals and a polymerase II
termination sequence. The initiation sequence was replaced at the 5’ proximal end and a sequence
which codes for an endoplasmic reticulum retenetion signal (SEKDEL) was added in before the stop
codon. GC content increased from 35% to 44%. The sVP6 gene has the same amino acid sequence as the
VP6 gene, but only 87.94% of the sequence is the same.
Publication Author(s)Dong,J.-L., Zhou,B., Sheng,G. and Wang,T.
Corresponding AuthorTao Wang
Corresponding AddressState Key Laboratory of Agrobiotechnology, China Agricultural University, Beijing 100094, China
Publication Year2005
Publication TitleTransgenic Tobacco Expressing a Modified VP6 Gene Protects Mice Against Rotavirus Infection
AbstractElevated expression of the rotavirus VP6 antigen in transgenic plants is a critical factor in the development of a safe and effective rotavirus vaccine. Using codon optimization, a gene that encodes the inner capsid protein VP6 of the human group A rotavirus was synthesized (sVP6). The VP6 and sVp6 genes were transformed into tobacco (Nicotiana tabacum L.) plants using Agrobacterium tumefaciens. The expression level of the sVP6 gene in transgenic plants was 3.8-C34-fold higher than that of controls containing the non-modified VP6 gene, accounting for up to 0.34% of the total soluble protein (TSP). Then, BALB/c female mice that had been gavaged weekly with 10 mg TSP containing 34 ug VP6 protein, in which VP6-specific serum IgG and mucosal IgA antibodies were investigated. The severity and duration of diarrhea caused by simian rotavirus SA-11 challenge were reduced significantly in passively immunized pups, which indicates that anti-VP6 antibodies generated in orally immunized female mice can be passed onto pups and provide heterotypic protection. An edible vaccine based on the VP6 of human rotavirus group A could provide a means to protect children and young animals from severe acute diarrhea.
JournalJ. Integr. Plant Biol.. 47(8): 978-987.
SummaryVP6, a useful antigen was codon optimized to improve protein production in this study. The synthetic sVP6 generated a significant amount, 3.8-34 times more than the unmodified gene, of protein in tobacco plants and then was used to immunize BALB/c female mice. The offspring of these mice were exposed to simian rotavirus SA-11. What can be concluded from this is that having a VP6 vaccine from the human rotavirus group A can be used to shorter the duration of diarrhea in children and animals. As expected, sVP6 was able to generate a significant amount of protein due to it being codon optimized for plants, and the addition of a SEKDEL sequence.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=553
PubMed ID0
Submitter NameQureshi, Imran
Submitter Address1000 Hilltop Circle Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site