Synthetic Gene DataBase
 

Synthetic Gene 55


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID4755
GenBank Accession
GenBank GI
Gene NameGFPncbGFPct
Gene Length (bp)717717
SpeciesAequorea victoriaEscherichia coli, Chlamydomonas reinhardtii
Strainschloroplast (alga), BL21 (E. coli)
CDSatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggt
gatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacactt
gtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaaacgg
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttc
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttctt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatgga
atcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtcctt
cttgactttgtaacagctgctgggattacacatggcatggatgaactatacaaataa
atggctaaaggtgaagaattattcacaggtgttgtacctattttagtagaattagacggt
gatgtaaacggtcacaaattttcagtttctggtgaaggtgaaggtgacgcaacttatggt
aaattaacacttaaattcatttgtactacaggtaaattaccagtaccttggccaacttta
gttacaacttttacatacggtgtacaatgtttcagtcgttaccctgatcacatgaaacaa
catgactttttcaaatctgctatgccagaaggttatgttcaagaacgtactatttttttc
aaagatgacggtaattataaaacacgtgctgaagtaaaatttgaaggtgatactttagtt
aaccgtattgaattaaaaggtattgacttcaaagaagatggtaatattttaggtcacaaa
cttgaatataactacaattcacataacgtatatattatggcagacaaacaaaaaaatggt
attaaagtaaactttaaaattcgtcataatatcgaggatggttctgtacaattagctgac
cactatcaacaaaacacaccaattggtgatggtcctgttttacttccagacaatcattat
ttaagtactcaatctgctttatcaaaagatcctaacgaaaaacgtgaccacatggtatta
cttgaatttgttacagcagctggtattactcacggtatggatgaattatacaaataa
5' End
3' End
NotesThis protein has a mutation (Q80R) relative to the wild-type GFP. The algal rbcL 5' and 3' UTRs were used to enhance expression.Two amino acid substitutions: S2A, S65T. C. reinhardtii rbcL 5' and 3' UTRs were used to enhance gene expression.
Expression VectorpETpET
Assay MethodsSDS-PAGE, Western blotSDS-PAGE, Western blot
ResultsStrong expression in E. coli but poor production in algal chloroplasts.The synthetic GFP expressed at similar level to natural form in E. coli. But C. reinhardii chloroplasts tranformed with synthetic GFP accumulated ~ 80 fold more GFP than a strain transformed with wild-type GFP.
Protein FunctionReporter gene
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usage was optimized according to codon preference in major chloroplast-encoding proteins.
Publication Author(s)Franklin, S.; Ngo, B.; Efuet, E.; Mayfield, S. P.
Corresponding AuthorScott Franklin and Stephen Mayfield
Corresponding AddressDepartment of Cell Biology and The Skaggs Institute for Chemical Biology, The Scripps Research Institute, 10550 N. Torrey Pines Road, La Jolla, CA 92037, USA. sefrankl@scripps.edu
Publication Year2002
Publication TitleDevelopment of a GFP reporter gene for Chlamydomonas reinhardtii chloroplast
AbstractReporter genes have been successfully used in chloroplasts of higher plants, and high levels of recombinant protein expression have been reported. Reporter genes have also been used in the chloroplast of Chlamydomonas reinhardtii, but in most cases the amounts of protein produced appeared to be very low. We hypothesized that the inability to achieve high levels of recombinant protein expression in the C. reinhardtii chloroplast was due to the codon bias seen in the C. reinhardtii chloroplast genome. To test this hypothesis, we synthesized a gene encoding green fluorescent protein (GFP) de novo, optimizing its codon usage to reflect that of major C. reinhardtii chloroplast-encoded proteins. We monitored the accumulation of GFP in C. reinhardtii chloroplasts transformed with the codon-optimized GFP cassette (GFPct), under the control of the C. reinhardtii rbcL 5'- and 3'-UTRs. We compared this expression with the accumulation of GFP in C. reinhardtii transformed with a non-optimized GFP cassette (GFPncb), also under the control of the rbcL 5'- and 3'-UTRs. We demonstrate that C. reinhardtii chloroplasts transformed with the GFPct cassette accumulate approximately 80-fold more GFP than GFPncb-transformed strains. We further demonstrate that expression from the GFPct cassette, under control of the rbcL 5'- and 3'-UTRs, is sufficiently robust to report differences in protein synthesis based on subtle changes in environmental conditions, showing the utility of the GFPct gene as a reporter of C. reinhardtii chloroplast gene expression.
JournalPlant J. 30(6): 733-44.
SummaryAn attempt was made to improve the expression of GFP in green alga Chlamydomonas reinhardtii through codon optimization. It was shown that the codon-optimized GFP accumulated ~ 80 fold higher than the natural form.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=498
PubMed ID12061904
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site