Synthetic Gene DataBase
 

Synthetic Gene 56


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID4956
GenBank AccessionAF067156
GenBank GI3252936
Gene NametatTat(co)
Gene Length (bp)306240
Specieshuman immunodeficiency virus (HIV1)Homo sapiens
StrainsType 1(human embryoic kedney (HEK) 293 cells
CDSatggagccagtagatcctaacctagagccctggaaccatccaggaagtcagcctagaact
gcttgcaacaactgttattgtaaacgctgtagctaccattgtctagtttgctttcagaaa
aaaggcttaggcatttcctatggcaggaagaagtggagacagcgacgaagagctcctcca
agtagtgaggatcatcaaaatcttatatcgaagcaacccataccccaaacccagggggac
tcgacaggcccggaagaatcgaagaagaagatggagagcaaggcaaagacagatcgattc
gattag
5' Endtaaggtacc
3' Endtctagaaaa
NotesOnly the exon 1 (1..215) was used in the studyThe manuscript containing the atucal sequence information was not published. So no sequence information for this gene.
Expression VectorpUMVC3pUMVC3
Assay MethodsSDS-PAGE and Western BlotSDS-PAGE and Western Blot
ResultsDetectable protein expression in human 293 cellsSlightly higher expression than the wild-type.
Protein Functiontransactivator protein
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodThe gene was optimized for codons most frequently used in mammals (Sharp et al. 1988, Nuc. Acids
Res.; Sharp et al. 1995, Philos Trans R. Sco. Lond. B. Biol. Sci.; Nakarmura et al. 2000, Nuc. Acids
Res.).
Publication Author(s)Ramakrishna, L.; Anand, K. K.; Mahalingam, M.; Mohankumar, K. M.; Ramani, S.; Siddappa, N. B.; Ranga, U.
Corresponding AuthorUdaykumar Ranga
Corresponding AddressMolecular Virology Laboratory, Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur (PO), Bangalore 560064, India.
Publication Year2004
Publication TitleCodon optimization and ubiquitin conjugation of human immunodeficiency virus-1 Tat lead to enhanced cell-mediated immune responses
AbstractThe transactivator protein, Tat, is a potential candidate for developing a vaccine against human immunodeficiency virus (HIV-1). Since Tat is not immunodominant, especially when delivered as a genetic vaccine, we expressed codon-optimized subtype-C Tat as a molecular conjugate of ubiquitin, to elicit antigen-specific cell-mediated immune responses. Immunization of mice with different ubiquitin-Tat constructs elicited a strong cellular, but not a humoral, immune response. The combination of codon-optimization and ubiquitin-mediated processing of Tat induced a Th-1 type cellular immune response that was detectable without in vitro stimulation, suggesting its potential utility for destruction of virus-infected cells via CTL-mediated lysis. Preliminary attempts at characterizing the immunodominant regions identified a novel T-helper epitope within the core domain of Tat.
JournalVaccine. 22(20): 2586-98.
Summarytat protein was codon optimized for expression in human cells to enhance the immunoactivity. It led to slight increase in protein expression level.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=528
PubMed ID15193384
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site