Synthetic Gene DataBase
 

Synthetic Gene 57


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID5057
GenBank AccessionAF531437AB181959
GenBank GI2234765854650283
Gene Nametransglutaminase (TGase)TGase
Gene Length (bp)12241131
SpeciesStreptomyces mobaraensisCandida boidinii and Pichia pastoris
StrainsIFO13819C.boidinii S2, TK62 and BUL, P.pastoris X33 and SMD1168
CDSatgcgcatacgccggagagctctcgtcttcgccactatgagtgcggtgttatgcaccgcc
ggattcatgccgtcggccggcgaggccgccgccgacaatggcgcgggggaagagacgaag
tcctacgccgaaacctaccgcctcacggcggatgacgtcgcgaacatcaacgcgctcaac
gaaagcgctccggccgcttcgagcgccggcccgtcgttccgggcccccgactccgacgac
agggtcacccctcccgccgagccgctcgacaggatgcccgacccgtaccgtccctcgtac
ggcagggccgagacggtcgtcaacaactacatacgcaagtggcagcaggtctacagccac
cgcgacggcaggaagcagcagatgaccgaggagcagcgggagtggctgtcctacggctgc
gtcggtgtcacctgggtcaattcgggtcagtacccgacgaacagactggccttcgcgtcc
ttcgacgaggacaggttcaagaacgagctgaagaacggcaggccccggtccggcgagacg
cgggcggagttcgagggccgcgtcgcgaaggagagcttcgacgaggagaagggcttccag
cgggcgcgtgaggtggcgtccgtcatgaacagggccctggagaacgcccacgacgagagc
gcttacctcgacaacctcaagaaggaactggcgaacggcaacgacgccctgcgcaacgag
gacgcccgttccccgttctactcggcgctgcggaacacgccgtccttcaaggagcggaac
ggaggcaatcacgacccgtccaggatgaaggccgtcatctactcgaagcacttctggagc
ggccaggaccggtcgagttcggccgacaagaggaagtacggcgacccggacgccttccgc
cccgccccgggcaccggcctggtcgacatgtcgagggacaggaacattccgcgcagcccc
accagccccggtgagggattcgtcaatttcgactacggctggttcggcgcccagacggaa
gcggacgccgacaagaccgtctggacccacggaaatcactatcacgcgcccaatggcagc
ctgggtgccatgcatgtctacgagagcaagttccgcaactggtccgagggttactcggac
ttcgaccgcggagcctatgtgatcaccttcatccccaagagctggaacaccgcccccgac
aaggtaaagcagggctggccgtga
gataatggtgctggtgaagaaactaaatcttatgctgaaacttatagattaactgctgat
gatgttgctaatattaatgctttaaatgaatctgctccagctgcttcttctgctggtcca
tcttttagagctccagattctgatgacagagtcactccaccagctgaaccattggataga
atgccagatccatacagaccatcttacggtagagctgaaactgttgtcaacaactacatt
agaaagtggcaacaagtctactctcacagagatggtagaaagcaacaaatgactgaagaa
caaagagaatggttgtcttacggttgtgttggtgttacttgggttaactctggtcaatac
ccaactaacagattggctttcgcttctttcgatgaagatagattcaagaacgaattgaag
aacggtagaccaagatccggtgaaactagagctgaattcgaaggtagagttgctaaggaa
tctttcgatgaagaaaagggtttccaaagagctagagaagttgcttctgttatgaacaga
gctctagaaaacgctcacgatgaatctgcttacttggataacttgaagaaggaattggcc
aacggtaacgatgctttgagaaacgaagatgctagatccccattctactctgctttgaga
aacactccatctttcaaggaaagaaacggtggtaaccacgatccatccagaatgaaggct
gttatttactctaagcacttctggtctggtcaagatagatcttcttctgctgataagaga
aagtacggtgatccagatgctttcagaccagctccaggtaccggtttggtcgacatgtcc
agagatagaaacattccaagatccccaacttctccaggtgaaggtttcgtcaacttcgat
tacggttggttcggtgctcaaactgaagctgatgctgataagactgtttggacccatggt
aaccactaccacgctccaaacggttctttgggtgctatgcacgtctacgaatctaagttc
agaaactggtctgaaggttactctgatttcgatagaggtgcttacgttattactttcatt
ccaaagtcttggaacactgctccagacaaggtcaagcaaggttggccataa
5' End
3' End
NotesThis sequence only codes for the mature protein.
Expression VectorNApPICZaB
Assay MethodsNASDS-PAGE, Western blot
ResultsExpression not determinedHigh yields of TGase proteins in both species.
Protein FunctionAn enzyme that catalyzes acyl transfer reactions between the gamma-carboxy-amide group of a glutamine residue in a peptide chain and the primary amine.
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usage was optimized according to the codon preferences in Candida boidinii.
Publication Author(s)Yurimoto H, Yamane M, Kikuchi Y, Matsui H, Kato N, Sakai Y.
Corresponding AuthorYasuyoshi Sakai
Corresponding AddressDivision of Applied Life Sciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502, Japan.
Publication Year2004
Publication TitleThe pro-peptide of Streptomyces mobaraensis transglutaminase functions in cis and in trans to mediate efficient secretion of active enzyme from methylotrophic yeasts.
AbstractTransglutaminase (TGase) from the actinomycete Streptomyces mobaraensis is a useful enzyme in the food industry, and development of an efficient production system for it would be desirable. Herein we report secretion of TGase in an enzymatically active form by methylotrophic yeasts as expression hosts. Secretory production of active TGase required a pro-peptide from TGase. When an artificial Kex2-endopeptidase recognition site was placed between the pro-peptide and mature TGase, secretion and in vitro maturation of TGase depended on Kex2-dependent cleavage. Unexpectedly, coexpression of unlinked pro-peptide with mature TGase yielded efficient secretion of the active enzyme. These results indicate that the pro-peptide from TGase functions not only in an intramolecular but also in an intermolecular manner. Site-directed mutagenesis of putative N-glycosylation sites increased the productivity of the active TGase further. A recombinant Candida boidinii strain was found to secrete active TGase up to 1.83 U/ml (about 90 mg/l) after 119 h of cultivation.
JournalBiosci Biotechnol Biochem.. 68(10): 2058-69.
SummaryA streptomyces gene TGase was codon optimized for expression in yeast and successfully expressed in both P. pastoris and C. boidinii.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=525
PubMed ID15502350
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site