Synthetic Gene DataBase
 

Synthetic Gene 58


 
  Welcome, Guest!

Field NameNatural GeneSynthetic Gene
SGDB Gene ID5158
GenBank AccessionL29345AY656807
GenBank GI60638350363240
Gene Namegreen fluorescent protein (GFP)yEGFP3
Gene Length (bp)717717
SpeciesAequorea victoriaCandida albicans
Strains
CDSatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggc
gatgttaatgggcaaaaattctctgtcagtggagagggtgaaggtgatgcaacatacgga
aaacttacccttaaatttatttgcactactgggaagctacctgttccatggccaacactt
gtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaaacag
catgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatattttac
aaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgtt
aatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa
atggaatacaactataactcacataatgtatacatcatggcagacaaaccaaagaatgga
atcaaagttaacttcaaaattagacacaacattaaagatggaagcgttcaattagcagac
cattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattac
ctgtccacacaatctgccctttccaaagatcccaacgaaaagagagatcacatgatcctt
cttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataa
atgtctaaaggtgaagaattattcactggtgttgtcccaattttggttgaattagatggt
gatgttaatggtcacaaattttctgtctccggtgaaggtgaaggtgatgctacttacggt
aaattgaccttaaaatttatttgtactactggtaaattgccagttccatggccaacctta
gtcactactttcggttatggtgttcaatgttttgcgagatacccagatcatatgaaacaa
catgactttttcaagtctgccatgccagaaggttatgttcaagaaagaactatttttttc
aaagatgacggtaactacaagaccagagctgaagtcaagtttgaaggtgataccttagtt
aatagaatcgaattaaaaggtattgattttaaagaagatggtaacattttaggtcacaaa
ttggaatacaactataactctcacaatgtttacatcatggctgacaaacaaaagaatggt
atcaaagttaacttcaaaattagacacaacattgaagatggttctgttcaattagctgac
cattatcaacaaaatactccaattggtgatggtccagtcttgttaccagacaaccattac
ttatccactcaatctgccttatccaaagatccaaacgaaaagagagaccacatggtcttg
ttagaatttgttactgctgctggtattacccatggtatggatgaattgtacaaataa
5' End
3' End
NotesAlso see GenBank Accession No. M62653, M62654. codon-optimized GFP containing S65G and S72A mutations; similar to GenBank Accession Number U73901 (Cormack et al. 1996, 1997)
Expression VectorNApBGSA
Assay MethodsNASDS-PAGE, Western blot
ResultsNot determinedNot reported.
Protein FunctionReporter gene
Recoding PurposeTo improve expression
Synthesized ByAuthors
Recoding MethodCodon usage was optimized for Candida albicans.
Publication Author(s)Granger BL, Flenniken ML, Davis DA, Mitchell AP, Cutler JE.
Corresponding AuthorBruce L. Granger
Corresponding AddressDepartment of Microbiology, Montana State University, Bozeman, MT, USA.
Publication Year2005
Publication TitleYeast wall protein 1 of Candida albicans.
AbstractYeast wall protein 1 (Ywp1, also called Pga24) of Candida albicans is predicted to be a 533 aa polypeptide with an N-terminal secretion signal, a C-terminal glycosylphosphatidylinositol anchor signal and a central region rich in serine and threonine. In yeast cultures, Ywp1p appeared to be linked covalently to glucans of the wall matrix, but, as cultures approached stationary phase, Ywp1p accumulated in the medium and was extractable from cells with disulfide-reducing agents. An 11 kDa propeptide of Ywp1p was also present in these soluble fractions; it possessed the sole N-glycan of Ywp1p and served as a useful marker for Ywp1p. DNA vaccines encoding all or part of Ywp1p generated analytically useful antisera in mice, but did not increase survival times for disseminated candidiasis. Replacement of the coding sequence of YWP1 with the fluorescent reporter GFP revealed that expression of YWP1 is greatest during yeast exponential-phase growth, but downregulated in stationary phase and upon filamentation. Expression was upregulated when the extracellular phosphate concentration was low. Disruption by homologous recombination of both YWP1 alleles resulted in no obvious change in growth, morphology or virulence, but the Ywp1p-deficient blastoconidia exhibited increased adhesiveness and biofilm formation, suggesting that Ywp1p may promote dispersal of yeast forms of C. albicans.
JournalMicrobiology. 151(5): 1631-44.
SummaryThe yGFP3 and HIS1 were used in this study as two selectable markers to study the function of yeast wall protein 1. No detailed information was given for the expression level.
Comments
Discussion http://www.evolvingcode.net/forum/viewtopic.php?t=510
PubMed ID15870471
Submitter NameWu, Gang
Submitter AddressDepartment of Biological Sciences, University of Maryland Baltimore County, 1000 Hilltop Circle, Baltimore, MD 21250 USA
Entry ConfirmationNo
 
 

Copyright 2004 the Freeland Bioinformatics Lab, All Rights Reserved. | Contact Us | About this site